MirGeneDB

MirGeneDB ID

Dme-Mir-92-o17

Family name MIR-92 (all species)
Seed AUUGCAC
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-311
Paralogues Dme-Mir-92-o14  Dme-Mir-92-o15  Dme-Mir-92-o16  Dme-Mir-92-o18  Dme-Mir-92-o19 
Orthologues Asu-Mir-92  Cel-Mir-92  Dan-Mir-92-o17  Dmo-Mir-92-o17  Isc-Mir-92 
Node of Origin (locus) Drosophila
Node of Origin (family) Bilateria
Genome context
(dm6)
chr2R: 20583888-20583946 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-o17)
Mir-92-o16 chr2R: 20583766-20583825 [-] UCSC Ensembl
Mir-92-o17 chr2R: 20583888-20583946 [-] UCSC Ensembl
Mir-92-o18 chr2R: 20584058-20584117 [-] UCSC Ensembl
Mir-92-o19 chr2R: 20584194-20584254 [-] UCSC Ensembl
Mir-991 chr2R: 20585214-20585275 [-] UCSC Ensembl
Mir-992 chr2R: 20585332-20585390 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGAAAAAUCGAAAUUUCUAGAUCAUUUUUCGGACGGUAUAUGGGUUAAUAUUUCAUUUGUCGAAUAUAUUGCACAUUCACCGGCCUGAAAAUAUCAAGAAUUAACAUCGAAAAGUGAA
Get precursor sequence
Structure
        10           20        30        40        50         
GUGAAAAAUCGAAAUUU---| A   C      C  A    AU   G  U     UUCAUU 
                    CU GAU AUUUUU GG CGGU  AUG GU AAUAU      U
                    GA CUA UAAAAG CC GCCA  UAC CG UUAUA      G
AAGUGAAAAGCUACAAUUAA^ A   -      U  G    CU   A  -     UAAGCU 
       110       100         90        80         70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-92-o17_5p*

MirBase accessionMIMAT0020837
Sequence
0- CGGACGGUAUAUGGGUUAAUAUU -23
Get sequence
Mature sequence

Dme-Mir-92-o17_3p

MirBase accessionMIMAT0000403
Sequence
37- UAUUGCACAUUCACCGGCCUGA -59
Get sequence
Validated targets microrna.org: MIMAT0000403
TargetScanFly: dme-miR-311