MirGeneDB

MirGeneDB ID

Dme-Mir-9-P10-v1

Family name MIR-9 (all species)
Seed AAAGCUA
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-79
Paralogues Dme-Mir-9-P7  Dme-Mir-9-P8  Dme-Mir-9-P9  Dme-Mir-9-P10-v2  Dme-Mir-9-P11 
Orthologues Aae-Mir-9-P10-v1  Aae-Mir-9-P10-v2  Cin-Mir-9  Cte-Mir-9  Dan-Mir-9-P10-v1  Dan-Mir-9-P10-v2  Dmo-Mir-9-P10-v1  Dmo-Mir-9-P10-v2  Hme-Mir-9-o10  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Diptera
Node of Origin (family) Bilateria
Genome context
(dm6)
chr2L: 16698572-16698634 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-P10-v1)
Mir-9-P9 chr2L: 16697936-16698005 [+] UCSC Ensembl
Mir-306 chr2L: 16698418-16698476 [+] UCSC Ensembl
Mir-9-P10-v1 chr2L: 16698572-16698634 [+] UCSC Ensembl
Mir-9-P10-v2 chr2L: 16698572-16698634 [+] UCSC Ensembl
Mir-9-P8 chr2L: 16698758-16698820 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGUGCCUUAGAGUGAAGCUGACUUGCCAUUGCUUUGGCGCUUUAGCUGUAUGAUAGAUUUAAACUACUUCAUAAAGCUAGAUUACCAAAGCAUUGGCUUCUGCAGGUCAAUCGUCAGAAACAA
Get precursor sequence
Structure
        10         20         30        40        50        60 
AGUGCCUUAGAGUGAAG-   ACUU-|   U        CGC       G    AUAGAUUU 
                  CUG     GCCA UGCUUUGG   UUUAGCU UAUG        \
                  GAC     CGGU ACGAAACC   AGAUCGA AUAC        A
AACAAAGACUGCUAACUG   GUCUU^   U        AUU       A    UUCAUCAA 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-9-P10-v1_5p*

MirBase accessionMIMAT0020814
Sequence
0- GCUUUGGCGCUUUAGCUGUAUG -22
Get sequence
Mature sequence

Dme-Mir-9-P10-v1_3p

MirBase accessionMIMAT0000352
Sequence
41- UAAAGCUAGAUUACCAAAGCAU -63
Get sequence
Validated targets microrna.org: MIMAT0000352
TargetScanFly: dme-miR-79