MirGeneDB

MirGeneDB ID

Dme-Mir-67-as

Family name MIR-67 (all species)
Seed CACACCC
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-307b
Paralogues Dme-Mir-67 
Orthologues Aae-Mir-67  Asu-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cel-Mir-67  Cte-Mir-67  Dan-Mir-67  Dan-Mir-67-as  Dmo-Mir-67  Dpu-Mir-67  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Lgi-Mir-67 
Node of Origin (locus) Drosophila melanogaster group
Node of Origin (family) Protostomia
Genome context
(dm6)
chr2R: 9621265-9621326 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-67-as)
Mir-67 chr2R: 9621261-9621326 [-] UCSC Ensembl
Mir-67-as chr2R: 9621265-9621326 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGUUUCGUGGAUACUCUGUCCUGCUAUCGCUCACUCAAGGAGGUUGUGAUGGAUACCAUAUCGAAAUAACAUCACACCCAGGUUGAGUGAGUCAAAGCAAGACAAAAUGCUGCUAACUUUGC
Get precursor sequence
Structure
        10          20        30        40        50        60
AGUUUCGUGGAUACUCU--|  C    AUC          GGA  U       GAUACCAU 
                   GUC UGCU   GCUCACUCAA   GG UGUGAUG        A
                   CAG ACGA   UGAGUGAGUU   CC ACACUAC        U
CGUUUCAAUCGUCGUAAAA^  A    AAC          GGA  C       AAUAAAGC 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-67-as_5p*

MirBase accessionMIMAT0012194
Sequence
0- UCACUCAAGGAGGUUGUGAUG -21
Get sequence
Validated targets microrna.org: MIMAT0012194
Mature sequence

Dme-Mir-67-as_3p

MirBase accessionMIMAT0012195
Sequence
41- UCACACCCAGGUUGAGUGAGU -62
Get sequence
Validated targets microrna.org: MIMAT0012195