MirGeneDB

MirGeneDB ID

Dme-Mir-2-P4b1

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-13b-1
Paralogues Dme-Mir-2-P1a-v1  Dme-Mir-2-P1a-v2  Dme-Mir-2-P1b-v1  Dme-Mir-2-P1b-v2  Dme-Mir-2-P2a  Dme-Mir-2-P2b  Dme-Mir-2-P3-v1  Dme-Mir-2-P3-v2  Dme-Mir-2-P4a  Dme-Mir-2-P4b2  Dme-Mir-2-P5  Dme-Mir-2-P6a  Dme-Mir-2-P6b  Dme-Mir-2-P6c  Dme-Mir-2-P7  Dme-Mir-2-P8  Dme-Mir-2-P9-v1  Dme-Mir-2-P9-v2 
Orthologues Aae-Mir-2-P4  Dan-Mir-2-P4b1  Dmo-Mir-2-P4b1  Dpu-Mir-2-o4 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(dm6)
chr3R: 15417411-15417470 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P4b1)
Mir-2-P4b1 chr3R: 15417411-15417470 [-] UCSC Ensembl
Mir-2-P4a chr3R: 15417547-15417609 [-] UCSC Ensembl
Mir-2-P3-v1 chr3R: 15417760-15417826 [-] UCSC Ensembl
Mir-2-P3-v2 chr3R: 15417760-15417826 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGACUGAACCACGUCUUUCUUAUACCAUGUCGUUAAAAUGUUUGUGAACUUAUGUAUUCACAAUCAUAUCACAGCCAUUUUGACGAGUUUGGGUAAAGAAAUCUCAACAUUGAACGGAU
Get precursor sequence
Structure
        10          20        30          40        50        60
CUGACUGAACCACGUCU--     A    AUG--|          U      ACU    UAUU 
                   UUCUU UACC     UCGUUAAAAUG UUGUGA   UAUG    C
                   AAGAA AUGG     AGCAGUUUUAC GACACU   AUAC    A
UAGGCAAGUUACAACUCUA     -    GUUUG^          C      ---    UAAC 
.       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-2-P4b1_5p*

MirBase accessionMIMAT0020796
Sequence
0- UCGUUAAAAUGUUUGUGAACUUAUG -25
Get sequence
Mature sequence

Dme-Mir-2-P4b1_3p

MirBase accessionMIMAT0000119
Sequence
37- UAUCACAGCCAUUUUGACGAGUU -60
Get sequence
Validated targets microrna.org: MIMAT0000119
TargetScanFly: dme-miR-13b