MirGeneDB

MirGeneDB ID

Dme-Mir-2-P1a-v2

Family name MIR-2 (all species)
Seed CACAGCC
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-2a-1
Paralogues Dme-Mir-2-P1a-v1  Dme-Mir-2-P1b-v1  Dme-Mir-2-P1b-v2  Dme-Mir-2-P2a  Dme-Mir-2-P2b  Dme-Mir-2-P3-v1  Dme-Mir-2-P3-v2  Dme-Mir-2-P4a  Dme-Mir-2-P4b1  Dme-Mir-2-P4b2  Dme-Mir-2-P5  Dme-Mir-2-P6a  Dme-Mir-2-P6b  Dme-Mir-2-P6c  Dme-Mir-2-P7  Dme-Mir-2-P8  Dme-Mir-2-P9-v1  Dme-Mir-2-P9-v2 
Orthologues Dan-Mir-2-P1a-v1  Dan-Mir-2-P1a-v2  Dmo-Mir-2-P1a-v1  Dmo-Mir-2-P1a-v2  Dpu-Mir-2-o1 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(dm6)
chr2L: 19569901-19569966 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P1a-v2)
Mir-2-P1b-v1 chr2L: 19569495-19569554 [-] UCSC Ensembl
Mir-2-P1b-v2 chr2L: 19569495-19569554 [-] UCSC Ensembl
Mir-2-P1a-v1 chr2L: 19569901-19569966 [-] UCSC Ensembl
Mir-2-P1a-v2 chr2L: 19569901-19569966 [-] UCSC Ensembl
Mir-2-P2b chr2L: 19570189-19570256 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUAAAACUAUAUUGGCGCAUUCAUGCUGGGCUCUCAAAGUGGUUGUGAAAUGCAUUUCCGCUUUGCGCGGCAUAUCACAGCCAGCUUUGAUGAGCUUAGCGUAAUGUAUCGUACAUCAAAUCAUAA
Get precursor sequence
Structure
        10           20        30          40        50        60 
AUAAAACUAUAUUGGCG---    C           -      -|        AAUGCAUUUCCG 
                    CAUU AUGCUGGGCUC UCAAAG UGGUUGUGA            C
                    GUAA UGCGAUUCGAG AGUUUC ACCGACACU            U
AAUACUAAACUACAUGCUAU    -           U      G^        AUACGGCGCGUU 
    120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-2-P1a-v2_5p*

MirBase accessionMIMAT0020780
Sequence
0- CUCUCAAAGUGGUUGUGAAA -20
Get sequence
Mature sequence

Dme-Mir-2-P1a-v2_3p

MirBase accessionMIMAT0000106
Sequence
44- UCACAGCCAGCUUUGAUGAGCU -66
Get sequence
Validated targets microrna.org: MIMAT0000106