MirGeneDB

MirGeneDB ID

Dan-Mir-968

Family name MIR-968 (all species)
Seed AAGUAGU
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Dme-Mir-968  Dmo-Mir-968 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dana_caf1)
scaffold_12943: 1815568-1815630 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AGGUUGAAUCCUAAAUUAUGGCAGUUUCCUUAAGUAGUAUCCAUUAAAGGGUCGUUAAUAUAUUCAAAGUGACCGUUUGAUGUACUACUUUAGGUAGCUCCAUUUAAAGUCGGCUAAAAUAAG
Get precursor sequence
Structure
        10           20        30        40        50        60  
AGGUUGAAUCCUAAAUU---|   C    U   U        UC       G     UUAAUAU 
                    AUGG AGUU CCU AAGUAGUA  CAUUAAA GGUCG       \
                    UACC UCGA GGA UUCAUCAU  GUAGUUU CCAGU       A
GAAUAAAAUCGGCUGAAAUU^   -    U   U        --       G     GAAACUU 
 120       110       100         90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-968_5p

MirBase accessionNone
Sequence
0- UAAGUAGUAUCCAUUAAAGGGUCG -24
Get sequence
Star sequence

Dan-Mir-968_3p*

MirBase accessionNone
Sequence
41- ACCGUUUGAUGUACUACUUUAG -63
Get sequence