MirGeneDB

MirGeneDB ID

Dan-Mir-92-o19

Family name MIR-92 (all species)
Seed AUUGCAC
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues Dan-Mir-92-o14  Dan-Mir-92-o15  Dan-Mir-92-o16  Dan-Mir-92-o17  Dan-Mir-92-o18 
Orthologues Asu-Mir-92  Cel-Mir-92  Dme-Mir-92-o19  Dmo-Mir-92-o19  Isc-Mir-92 
Node of Origin (locus) Drosophila
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13266: 4132825-4132881 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-o19)
Mir-92-o18 scaffold_13266: 4132688-4132749 [+] Ensembl
Mir-92-o17 scaffold_13266: 4132944-4133001 [+] Ensembl
Mir-92-o16 scaffold_13266: 4133064-4133125 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAGUGUUUAGAACUUCGAUUUUAUUUGUAGGUCGCGGAAGGUUGCAAUGCGUAUUUUGAAUCGUAUUGCACUUUCCCCGGCCCAUAGAUAUUAUACGAACAGCAGCGAUCGCUAU
Get precursor sequence
Structure
        10          20        30        40        50        
AAAAGUGUUUAGAACUU-  -| UU       A     C       U        UAUU 
                  CG AU  UAUUUGU GGUCG GGAAGGU GCAAUGCG    U
                  GC UA  AUAGAUA CCGGC CCUUUCA CGUUAUGC    U
UAUCGCUAGCGACGACAA  A^ UU       C     C       -        UAAG 
     110       100        90        80         70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. There is a second Drosha site -1 on the 5p arm relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-92-o19_5p*

MirBase accessionNone
Sequence
0- AGGUCGCGGAAGGUUGCAAUGCG -23
Get sequence
Mature sequence

Dan-Mir-92-o19_3p

MirBase accessionNone
Sequence
35- UAUUGCACUUUCCCCGGCCCAU -57
Get sequence