MirGeneDB

MirGeneDB ID

Dan-Mir-92-o16

Family name MIR-92 (all species)
Seed AUUGCAC
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-310
Paralogues Dan-Mir-92-o14  Dan-Mir-92-o15  Dan-Mir-92-o17  Dan-Mir-92-o18  Dan-Mir-92-o19 
Orthologues Asu-Mir-92  Cel-Mir-92  Dme-Mir-92-o16  Dmo-Mir-92-o16  Isc-Mir-92 
Node of Origin (locus) Drosophila
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13266: 4133064-4133125 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-o16)
Mir-92-o18 scaffold_13266: 4132688-4132749 [+] Ensembl
Mir-92-o17 scaffold_13266: 4132944-4133001 [+] Ensembl
Mir-92-o16 scaffold_13266: 4133064-4133125 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUGCGAAAAUAGCAAAACAUAAACACUUGCAGGACGGGGAGCGUGACAAUAUAUAUAUUUUAUAAACAUAUAUUGCACACCUCCCGGCCUAUAAGUGUAAAUGUUCCUACAGGUAAAACUUC
Get precursor sequence
Structure
        10          20        30        40         50        60 
GUGCGAAAAUAGCAAAA--|  AA       C   ACG     C   A-       UAUAUUU 
                   CAU  ACACUUG AGG   GGGAG GUG  CAAUAUA       \
                   GUA  UGUGAAU UCC   CCCUC CAC  GUUAUAU       U
CUUCAAAAUGGACAUCCUU^  AA       A   GG-     -   AC       ACAAAUA 
120       110       100        90          80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data.
3' NTU No
MotifsNo
Tissue expression
 +
Da
Star sequence

Dan-Mir-92-o16_5p*

MirBase accessionNone
Sequence
0- AGGACGGGGAGCGUGACAAUAUA -23
Get sequence
Mature sequence

Dan-Mir-92-o16_3p

MirBase accessionMIMAT0008425
Sequence
40- UAUUGCACACCUCCCGGCCUAU -62
Get sequence