MirGeneDB

MirGeneDB ID

Dan-Mir-92-o15

Family name MIR-92 (all species)
Seed AUUGCAC
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-92b
Paralogues Dan-Mir-92-o14  Dan-Mir-92-o16  Dan-Mir-92-o17  Dan-Mir-92-o18  Dan-Mir-92-o19 
Orthologues Asu-Mir-92  Cel-Mir-92  Dme-Mir-92-o15  Dmo-Mir-92-o15  Isc-Mir-92 
Node of Origin (locus) Drosophila
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13340: 3732660-3732721 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-o15)
Mir-92-o14 scaffold_13340: 3727792-3727850 [+] Ensembl
Mir-92-o15 scaffold_13340: 3732660-3732721 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGUGAAGCAUUAAAACGUCACCUGAUGUAGGCCGUGCCCGGUGCUUAUUUGUUACUUUUGGAAAUACAAAUUGCACUAGUCCCGGCCUGCAGUGAGUGUCAAAGGCAGCUAUCUUCACUG
Get precursor sequence
Structure
        10              20        30         40        50        60 
GCAGUGAAGCAUUAAAACG------|   CUGA         U-  CC     UU     UUACUUU 
                         UCAC    UGUAGGCCG  GC  GGUGC  AUUUG       \
                         AGUG    ACGUCCGGC  UG  UCACG  UAAAC       U
GUCACUUCUAUCGACGGAAACUGUG^   ----         CC  A-     U-     AUAAAGG 
120       110       100            90        80          70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-92-o15_5p*

MirBase accessionNone
Sequence
0- AGGCCGUGCCCGGUGCUUAUUUG -23
Get sequence
Mature sequence

Dan-Mir-92-o15_3p

MirBase accessionMIMAT0008405
Sequence
40- AAUUGCACUAGUCCCGGCCUGC -62
Get sequence