MirGeneDB

MirGeneDB ID

Dan-Mir-9-P7

Family name MIR-9 (all species)
Seed CUUUGGU
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-9a
Paralogues Dan-Mir-9-P8  Dan-Mir-9-P9  Dan-Mir-9-P10-v1  Dan-Mir-9-P10-v2  Dan-Mir-9-P11 
Orthologues Aae-Mir-9-P7a  Aae-Mir-9-P7b  Cin-Mir-9  Cte-Mir-9  Dme-Mir-9-P7  Dmo-Mir-9-P7  Hme-Mir-9-o7  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Diptera
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13337: 17332447-17332507 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AUCUUAUAUAACACUAUGGGUGCUAUGUUGUCUUUGGUUAUCUAGCUGUAUGAGUGAUAAAUAACGUCAUAAAGCUAGCUUACCGAAGUUAAUAUUAGCGUCUGUCCAGCGAAACAGUCCA
Get precursor sequence
Structure
        10         20         30        40        50          
AUCUUAUAUAACACUAU-  GU   -|     U       UAU      G     GUGAUA 
                  GG  GCU AUGUUG CUUUGGU   CUAGCU UAUGA      \
                  UC  CGA UAUAAU GAAGCCA   GAUCGA AUACU      A
ACCUGACAAAGCGACCUG  UG   U^     U       UUC      A     GCAAUA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Da
Mature sequence

Dan-Mir-9-P7_5p

MirBase accessionMIMAT0008458
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Dan-Mir-9-P7_3p*

MirBase accessionNone
Sequence
38- AUAAAGCUAGCUUACCGAAGUUA -61
Get sequence