MirGeneDB

MirGeneDB ID

Dan-Mir-9-P10-v1

Family name MIR-9 (all species)
Seed AAAGCUA
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-79
Paralogues Dan-Mir-9-P7  Dan-Mir-9-P8  Dan-Mir-9-P9  Dan-Mir-9-P10-v2  Dan-Mir-9-P11 
Orthologues Aae-Mir-9-P10-v1  Aae-Mir-9-P10-v2  Cin-Mir-9  Cte-Mir-9  Dme-Mir-9-P10-v1  Dme-Mir-9-P10-v2  Dmo-Mir-9-P10-v1  Dmo-Mir-9-P10-v2  Hme-Mir-9-o10  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Diptera
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_12916: 15864734-15864795 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-P10-v1)
Mir-9-P8 scaffold_12916: 15864555-15864614 [-] Ensembl
Mir-9-P10-v1 scaffold_12916: 15864734-15864795 [-] Ensembl
Mir-9-P10-v2 scaffold_12916: 15864734-15864795 [-] Ensembl
Mir-306 scaffold_12916: 15864875-15864933 [-] Ensembl
Mir-9-P9 scaffold_12916: 15865484-15865553 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UAUAUAGUGUUCUAUAGCUGCUUAACCGAUGCUUUGGCGCUUUAGCUGUAUGAUAGAUUUAAAUACUUCAUAAAGCUAGAUUACCAAAGCAUUGGCUUCCGCAGGCCUGUCUUCAAGGAAUA
Get precursor sequence
Structure
        10         20         30        40        50        60
UAUAUAGUGUUCUAUAG-    UU  -|           CGC       G    AUAGAUU 
                  CUGC  AA CCGAUGCUUUGG   UUUAGCU UAUG       U
                  GACG  UU GGUUACGAAACC   AGAUCGA AUAC       A
AUAAGGAACUUCUGUCCG    CC  C^           AUU       A    UUCAUAA 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Star sequence

Dan-Mir-9-P10-v1_5p*

MirBase accessionNone
Sequence
0- GCUUUGGCGCUUUAGCUGUAUG -22
Get sequence
Mature sequence

Dan-Mir-9-P10-v1_3p

MirBase accessionMIMAT0008430
Sequence
40- UAAAGCUAGAUUACCAAAGCAU -62
Get sequence