MirGeneDB

MirGeneDB ID

Dan-Mir-87-v2

Family name MIR-87 (all species)
Seed GAGCAAA
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-87
Paralogues Dan-Mir-87-v1 
Orthologues Aae-Mir-87  Dme-Mir-87-v2  Dmo-Mir-87-v2  Hme-Mir-87  Lgi-Mir-87 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_12916: 13789788-13789859 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-87-v2)
Mir-87-v1 scaffold_12916: 13789788-13789859 [-] Ensembl
Mir-87-v2 scaffold_12916: 13789788-13789859 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAGUGAAUCCUUUCAAGCGGCAUAUUUCAUUCGCGCCUGUAUCUUGCUGAACCGUUACCGAUAUGGCACAGAAUCCGGUUGAGCAAAAUUUCAGGUGUGUGAGAAAUUUGUUAAGCAAUCUUCAAAAGAUAG
Get precursor sequence
Structure
        10          20        30        40         50        60     
AAGUGAAUCCUUUCAAGC--    U     AUU        U-| C     G   CGUUACCGAUAU 
                    GGCA AUUUC   CGCGCCUG  AU UUGCU AAC            \
                    UUGU UAAAG   GUGUGGAC  UA AACGA UUG            G
GAUAGAAAACUUCUAACGAA    U     AGU        UU^ A     G   GCCUAAGACACG 
130       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-87-v2_5p*

MirBase accessionNone
Sequence
0- UCGCGCCUGUAUCUUGCUGAAC -22
Get sequence
Mature sequence

Dan-Mir-87-v2_3p

MirBase accessionMIMAT0008411
Sequence
49- UGAGCAAAAUUUCAGGUGUGUGA -72
Get sequence