MirGeneDB

MirGeneDB ID

Dan-Mir-67-as

Family name MIR-67 (all species)
Seed CUCACUC
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues Dan-Mir-67 
Orthologues Aae-Mir-67  Asu-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cel-Mir-67  Cte-Mir-67  Dme-Mir-67  Dme-Mir-67-as  Dmo-Mir-67  Dpu-Mir-67  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Lgi-Mir-67 
Node of Origin (locus) Drosophila melanogaster group
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13266: 12795494-12795559 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUAGUCUUGUGGAUACUCUGUCCUGCUAUCGCUCACUCAAGGAGGUUGUGAUGGAUACCAUAUCGAAAUAACAUCACACCCAGGUUGAGUGAGUCAAAGCAAGACAAAAAGGCUGCUAACUUUCGU
Get precursor sequence
Structure
        10          20        30        40        50        60  
UUAGUCUUGUGGAUACUC--|   C    AUC          GGA  U       GAUACCAU 
                    UGUC UGCU   GCUCACUCAA   GG UGUGAUG        A
                    ACAG ACGA   UGAGUGAGUU   CC ACACUAC        U
UGCUUUCAAUCGUCGGAAAA^   A    AAC          GGA  C       AAUAAAGC 
    120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-67-as_5p

MirBase accessionNone
Sequence
0- GCUCACUCAAGGAGGUUGUGAUG -23
Get sequence
Co-mature sequence

Dan-Mir-67-as_3p

MirBase accessionNone
Sequence
43- UCACACCCAGGUUGAGUGAGUCA -66
Get sequence