MirGeneDB

MirGeneDB ID

Dan-Mir-29-P2

Family name MIR-29 (all species)
Seed AGCACCA
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-285
Paralogues Dan-Mir-29-P1c  Dan-Mir-29-P1d 
Orthologues Aae-Mir-29-P2  Aca-Mir-29-P2a  Aca-Mir-29-P2b-v1  Aca-Mir-29-P2b-v2  Ami-Mir-29-P2a-v1  Ami-Mir-29-P2a-v2  Ami-Mir-29-P2b-v1  Ami-Mir-29-P2b-v2  Asu-Mir-29-P2  Bfl-Mir-29-P2  Bge-Mir-29-P2e  Bge-Mir-29-P2f  Bta-Mir-29-P2a  Bta-Mir-29-P2b5  Bta-Mir-29-P2b6  Cbr-Mir-29-P2  Cel-Mir-29-P2  Cfa-Mir-29-P2a  Cfa-Mir-29-P2b-v1  Cfa-Mir-29-P2b-v2  Cgi-Mir-29-P2  Cli-Mir-29-P2a  Cli-Mir-29-P2b-v1  Cli-Mir-29-P2b-v2  Cpi-Mir-29-P2a  Cpi-Mir-29-P2b-v1  Cpi-Mir-29-P2b-v2  Cpo-Mir-29-P2a  Cpo-Mir-29-P2b  Cte-Mir-29-P2  Dme-Mir-29-P2  Dmo-Mir-29-P2  Dno-Mir-29-P2a  Dno-Mir-29-P2b-v1  Dno-Mir-29-P2b-v2  Dre-Mir-29-P2a  Dre-Mir-29-P2b1  Dre-Mir-29-P2b2  Efe-Mir-29-P2c  Efe-Mir-29-P2d  Ete-Mir-29-P2a  Ete-Mir-29-P2b-v1  Ete-Mir-29-P2b-v2  Gga-Mir-29-P2a  Gga-Mir-29-P2b-v1  Gga-Mir-29-P2b-v2  Hme-Mir-29-P2  Hsa-Mir-29-P2a  Hsa-Mir-29-P2b-v1  Hsa-Mir-29-P2b-v2  Lan-Mir-29-P2g  Lan-Mir-29-P2h  Mdo-Mir-29-P2a  Mdo-Mir-29-P2b-v1  Mdo-Mir-29-P2b-v2  Mml-Mir-29-P2a  Mml-Mir-29-P2b-v1  Mml-Mir-29-P2b-v2  Mmu-Mir-29-P2a  Mmu-Mir-29-P2b  Oan-Mir-29-P2a  Oan-Mir-29-P2b-v1  Oan-Mir-29-P2b-v2  Ocu-Mir-29-P2a  Ocu-Mir-29-P2b  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Rno-Mir-29-P2a  Rno-Mir-29-P2b3  Rno-Mir-29-P2b4  Sha-Mir-29-P2a  Sha-Mir-29-P2b-v1  Sha-Mir-29-P2b-v2  Sko-Mir-29-P2  Spu-Mir-29-P2  Sto-Mir-29-P2a  Sto-Mir-29-P2b  Tca-Mir-29-P2  Tgu-Mir-29-P2a  Tgu-Mir-29-P2b-v1  Tgu-Mir-29-P2b-v2  Xtr-Mir-29-P2a  Xtr-Mir-29-P2b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13337: 6191364-6191437 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUAGCUAGCCAGGAUAAUUCGAAUCAAAGAACUGAGAUCGAUUGGUGCAUAGAUAUCAAGGAGAUCCGAUCAUUUCAAUUCUAGCACCAUUCGAAAUCAGUGCUUUUGAUAAGAACCACUCAACAGAUAAAGUG
Get precursor sequence
Structure
        10          20        30         40        50        60      
UUAGCUAGCCAGGAUAA--   GA       A-|    GA    U      A    UAUCAAGGAGAU 
                   UUC  AUCAAAG  ACUGA  UCGA UGGUGC UAGA            C
                   AAG  UAGUUUU  UGACU  AGCU ACCACG AUCU            C
GUGAAAUAGACAACUCACC   AA       CG^    AA    U      -    UAACUUUACUAG 
  130       120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-29-P2_5p*

MirBase accessionNone
Sequence
0- ACUGAGAUCGAUUGGUGCAUAGA -23
Get sequence
Mature sequence

Dan-Mir-29-P2_3p

MirBase accessionMIMAT0008419
Sequence
51- UAGCACCAUUCGAAAUCAGUGCU -74
Get sequence