MirGeneDB

MirGeneDB ID

Dan-Mir-29-P1d

Family name MIR-29 (all species)
Seed AGCACCA
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues Dan-Mir-29-P1c  Dan-Mir-29-P2 
Orthologues Aae-Mir-29-P1d  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bge-Mir-29-P1d  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cte-Mir-29-P1  Dme-Mir-29-P1d  Dmo-Mir-29-P1d  Dpu-Mir-29-P1d  Hme-Mir-29-P1d  Isc-Mir-29-P1  Lgi-Mir-29-P1  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Sko-Mir-29-P1  Spu-Mir-29-P1  Tca-Mir-29-P1d 
Node of Origin (locus) Pancrustacea
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13340: 5676226-5676342 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CGUCUCCUCUCGUGUCAAAUUCAUUUUGGAACUGAAUUCUCGUGGGUCUGCACUGACAACACUGACCUGCUGCUGCUGCUGCUCUCCAGUUUGGCCAAUUUUGUUAAUUUUGAAAUUGAAAUUUUGUAGCACCAUGAGAUUCAGCUCUGGCGUGAAUUUCAAACAUGCAUCCACCAA
Get precursor sequence
Structure
        10          20        30        40        50        60        70        80        
CGUCUCCUCUCGUGUCA--|      U UG  A      U       GU     CUGACAACACUGACCUGCUGCUGCUGCUGCUCUCC 
                   AAUUCAU U  GA CUGAAU CUCGUGG  CUGCA                                   A
                   UUAAGUG G  CU GACUUA GAGUACC  GAUGU                                   G
AACCACCUACGUACAAACU^      C GU  C      -       AC     UUUAAAGUUAAAGUUUUAAUUGUUUUAACCGGUUU 
     170       160       150       140        130       120       110       100        90
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Star sequence

Dan-Mir-29-P1d_5p*

MirBase accessionNone
Sequence
0- ACUGAAUUCUCGUGGGUCUGCA -22
Get sequence
Mature sequence

Dan-Mir-29-P1d_3p

MirBase accessionNone
Sequence
96- UAGCACCAUGAGAUUCAGCUC -117
Get sequence