MirGeneDB

MirGeneDB ID

Dan-Mir-281-P2-v2

Family name MIR-281 (all species)
Seed GUCAUGG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-281-2
Paralogues Dan-Mir-281-P1-v1  Dan-Mir-281-P1-v2  Dan-Mir-281-P2-v1 
Orthologues Aae-Mir-281  Asu-Mir-281  Bfl-Mir-281  Bge-Mir-281  Cgi-Mir-281  Cin-Mir-281  Cte-Mir-281  Dme-Mir-281-P2-v1  Dme-Mir-281-P2-v2  Dmo-Mir-281-P2-v1  Dmo-Mir-281-P2-v2  Dpu-Mir-281  Hme-Mir-281  Isc-Mir-281  Pfl-Mir-281  Sko-Mir-281  Sto-Mir-281  Tca-Mir-281 
Node of Origin (locus) Drosophila
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13266: 2568953-2569021 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-281-P2-v2)
Mir-281-P1-v1 scaffold_13266: 2568766-2568828 [+] Ensembl
Mir-281-P1-v2 scaffold_13266: 2568767-2568827 [+] Ensembl
Mir-281-P2-v1 scaffold_13266: 2568952-2569020 [+] Ensembl
Mir-281-P2-v2 scaffold_13266: 2568953-2569021 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CGCAAGGAUACUCCACGAAUAGUGAAAUGAAGAGAGCUAUCCGUCGACAGUCAAGUUAAAACACGGAUUGUAAUACUGUCAUGGAAUUGCUCUCUUUGUAUAACAUUCGAAAGGCGACGAUAUCGGUGU
Get precursor sequence
Structure
        10        20            30         40        50        60   
CGCAAGGAUACUCCACGAAUA----  GAA UG        UA-|    C      CAAGUUAAAAC 
                         GU   A  AAGAGAGC   UCCGU GACAGU           \
                         CA   U  UUCUCUCG   AGGUA CUGUCA           A
UGUGGCUAUAGCAGCGGAAAGCUUA  AUA GU        UUA^    -      UAAUGUUAGGC 
       120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-281-P2-v2_5p*

MirBase accessionMIMAT0009182
Sequence
0- AGAGAGCUAUCCGUCGACAGUCA -23
Get sequence
Mature sequence

Dan-Mir-281-P2-v2_3p

MirBase accessionMIMAT0008429
Sequence
46- UGUCAUGGAAUUGCUCUCUUUGU -69
Get sequence