MirGeneDB

MirGeneDB ID

Dan-Mir-252-P2

Family name MIR-252 (all species)
Seed UAAGUAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues Dan-Mir-252-P1-v1  Dan-Mir-252-P1-v2 
Orthologues Asu-Mir-252-P2  Bfl-Mir-252-P2  Bge-Mir-252-P2  Cbr-Mir-252-P2  Cel-Mir-252-P2  Cgi-Mir-252-P2  Cte-Mir-252-P2  Dme-Mir-252-P2  Dmo-Mir-252-P2  Dpu-Mir-252-P2  Hme-Mir-252-P2  Isc-Mir-252-P2  Lan-Mir-252-P2a  Lan-Mir-252-P2b  Lgi-Mir-252-P2  Pfl-Mir-252-P2  Pmi-Mir-252-P2  Sko-Mir-252-P2  Spu-Mir-252-P2  Tca-Mir-252-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_12943: 1815419-1815480 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AUAAAUAUCUGUGCAAACUAAAUCAUGUGUUUAAGUAGGCAAUACAUGGGCGACUAAAUAAAAUAUACUCGCAAUGUAUAGCCUACAUAACUAGUUGAUUUUUGCAAGCAUCCAUUACAAAU
Get precursor sequence
Structure
        10          20         30        40        50        60 
AUAAAUAUCUGUGCAAACU--      UGU-|  UAA      A      GG    CUAAAUA 
                     AAAUCA    GUU   GUAGGC AUACAU  GCGA       \
                     UUUAGU    CAA   CAUCCG UAUGUA  CGCU       A
UAAACAUUACCUACGAACGUU      UGAU^  UA-      A      A-    CAUAUAA 
120       110       100        90         80         70
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-252-P2_5p

MirBase accessionNone
Sequence
0- UUAAGUAGGCAAUACAUGGGCGA -23
Get sequence
Star sequence

Dan-Mir-252-P2_3p*

MirBase accessionNone
Sequence
40- GCAAUGUAUAGCCUACAUAACU -62
Get sequence