MirGeneDB

MirGeneDB ID

Dan-Mir-252-P1-v2

Family name MIR-252 (all species)
Seed AAGUACU
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues Dan-Mir-252-P1-v1  Dan-Mir-252-P2 
Orthologues Aae-Mir-252-P1  Bfl-Mir-252-P1  Bge-Mir-252-P1-v1  Bge-Mir-252-P1-v2  Cbr-Mir-252-P1  Cel-Mir-252-P1  Cgi-Mir-252-P1  Cte-Mir-252-P1  Dme-Mir-252-P1-v1  Dme-Mir-252-P1-v2  Dmo-Mir-252-P1-v1  Dmo-Mir-252-P1-v2  Dpu-Mir-252-P1-v1  Dpu-Mir-252-P1-v2  Hme-Mir-252-P1  Isc-Mir-252-P1-v1  Isc-Mir-252-P1-v2  Lan-Mir-252-P1a  Lan-Mir-252-P1b  Lgi-Mir-252-P1  Pfl-Mir-252-P1  Pmi-Mir-252-P1  Sko-Mir-252-P1  Spu-Mir-252-P1  Tca-Mir-252-P1 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13340: 1848690-1848754 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CUUACAUUACUUCCUGCGAAGUCGCUUUCCUAAGUACUAGUGCCGCAGGAGUUAGGUUCGUGUCCGCAAUACCUCCUGCUGCCCAAGUGCUUAUUAAAGCGGCGAGUUGUCCAGCAAAAUACAAG
Get precursor sequence
Structure
        10        20          30        40        50        60  
CUUACAUUACUUCCUGCGAA--|       CC        AGU  C       UUAGGUUCGU 
                      GUCGCUUU  UAAGUACU   GC GCAGGAG          \
                      CGGCGAAA  AUUCGUGA   CG CGUCCUC          G
GAACAUAAAACGACCUGUUGAG^       UU        ACC  U       CAUAACGCCU 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-252-P1-v2_5p

MirBase accessionNone
Sequence
0- UAAGUACUAGUGCCGCAGGAGU -22
Get sequence
Star sequence

Dan-Mir-252-P1-v2_3p*

MirBase accessionNone
Sequence
43- UCCUGCUGCCCAAGUGCUUAUU -65
Get sequence