MirGeneDB

MirGeneDB ID

Dan-Mir-2-P4b2

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-13b-2
Paralogues Dan-Mir-2-P1a-v1  Dan-Mir-2-P1a-v2  Dan-Mir-2-P1b-v1  Dan-Mir-2-P1b-v2  Dan-Mir-2-P2a-v1  Dan-Mir-2-P2a-v2  Dan-Mir-2-P2b  Dan-Mir-2-P3-v1  Dan-Mir-2-P3-v2  Dan-Mir-2-P4a  Dan-Mir-2-P4b1  Dan-Mir-2-P5  Dan-Mir-2-P6a  Dan-Mir-2-P6b  Dan-Mir-2-P6c  Dan-Mir-2-P7  Dan-Mir-2-P8  Dan-Mir-2-P9 
Orthologues Aae-Mir-2-P4  Dme-Mir-2-P4b2  Dmo-Mir-2-P4b2  Dpu-Mir-2-o4 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13047: 797494-797554 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CCGCUUCUGCUUCAUUACCUGUUUCCCAGCGCGUCGAAAUGACUGUGACUUAUGCGUAUUUGAUGUCAUAUCACAGCCAUUUUGACGAGUUUGGUGGACAGUGAAAGUCAUCGGCGCGAGA
Get precursor sequence
Structure
        10          20         30        40        50        60
CCGCUUCUGCUUCAUUAC--     UC  -|  G          A      CU    CGUAU 
                    CUGUU  CC AGC CGUCGAAAUG CUGUGA  UAUG     U
                    GACAG  GG UUG GCAGUUUUAC GACACU  AUAC     U
AGAGCGCGGCUACUGAAAGU     GU  U^  A          C      --    UGUAG 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-2-P4b2_5p*

MirBase accessionNone
Sequence
0- GCGUCGAAAUGACUGUGACUUAUG -24
Get sequence
Mature sequence

Dan-Mir-2-P4b2_3p

MirBase accessionMIMAT0008426
Sequence
38- UAUCACAGCCAUUUUGACGAGUU -61
Get sequence