MirGeneDB

MirGeneDB ID

Dan-Mir-2-P4b1

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-13b-1
Paralogues Dan-Mir-2-P1a-v1  Dan-Mir-2-P1a-v2  Dan-Mir-2-P1b-v1  Dan-Mir-2-P1b-v2  Dan-Mir-2-P2a-v1  Dan-Mir-2-P2a-v2  Dan-Mir-2-P2b  Dan-Mir-2-P3-v1  Dan-Mir-2-P3-v2  Dan-Mir-2-P4a  Dan-Mir-2-P4b2  Dan-Mir-2-P5  Dan-Mir-2-P6a  Dan-Mir-2-P6b  Dan-Mir-2-P6c  Dan-Mir-2-P7  Dan-Mir-2-P8  Dan-Mir-2-P9 
Orthologues Aae-Mir-2-P4  Dme-Mir-2-P4b1  Dmo-Mir-2-P4b1  Dpu-Mir-2-o4 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13340: 12827487-12827547 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P4b1)
Mir-2-P4b1 scaffold_13340: 12827487-12827547 [-] Ensembl
Mir-2-P4a scaffold_13340: 12827632-12827693 [-] Ensembl
Mir-2-P3-v1 scaffold_13340: 12827849-12827913 [-] Ensembl
Mir-2-P3-v2 scaffold_13340: 12827849-12827913 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
ACCGAUUGUGUUCAUCUUUCUUAUACCAUGUCGUUAAAAGGCUUGUGACCUUAUGUAUUUCGCAAUCAUAUCACAGCCAUUUUGACGAGUUUGGGUAAAGAAAUCUCACCAUUCGACGCCC
Get precursor sequence
Structure
        10          20        30           40        50        60 
ACCGAUUGUGUUCAUCU--     A    AUG--         -|   U    CCU    UAUUU 
                   UUCUU UACC     UCGUUAAAA GGCU GUGA   UAUG     \
                   AAGAA AUGG     AGCAGUUUU CCGA CACU   AUAC     C
CCCGCAGCUUACCACUCUA     -    GUUUG         A^   -    ---    UAACG 
 .       110       100         90        80            70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-2-P4b1_5p*

MirBase accessionNone
Sequence
0- UCGUUAAAAGGCUUGUGACCUUAUG -25
Get sequence
Mature sequence

Dan-Mir-2-P4b1_3p

MirBase accessionMIMAT0008426
Sequence
38- UAUCACAGCCAUUUUGACGAGUU -61
Get sequence