MirGeneDB

MirGeneDB ID

Dan-Mir-2-P4a

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-13a
Paralogues Dan-Mir-2-P1a-v1  Dan-Mir-2-P1a-v2  Dan-Mir-2-P1b-v1  Dan-Mir-2-P1b-v2  Dan-Mir-2-P2a-v1  Dan-Mir-2-P2a-v2  Dan-Mir-2-P2b  Dan-Mir-2-P3-v1  Dan-Mir-2-P3-v2  Dan-Mir-2-P4b1  Dan-Mir-2-P4b2  Dan-Mir-2-P5  Dan-Mir-2-P6a  Dan-Mir-2-P6b  Dan-Mir-2-P6c  Dan-Mir-2-P7  Dan-Mir-2-P8  Dan-Mir-2-P9 
Orthologues Aae-Mir-2-P4  Dme-Mir-2-P4a  Dmo-Mir-2-P4a  Dpu-Mir-2-o4 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13340: 12827632-12827693 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P4a)
Mir-2-P4b1 scaffold_13340: 12827487-12827547 [-] Ensembl
Mir-2-P4a scaffold_13340: 12827632-12827693 [-] Ensembl
Mir-2-P3-v1 scaffold_13340: 12827849-12827913 [-] Ensembl
Mir-2-P3-v2 scaffold_13340: 12827849-12827913 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAGGACGAUCCAUCGAGUUCUUACGUAACUCCUCAAAGGGCUGUGAAAUGUUGCCAUUAUCUACUCAUAUCACAGCCAUUUUGAUGAGUUUCGUGGGAAUCGUCAGAAAACCGUCAGAAA
Get precursor sequence
Structure
        10          20        30        40         50          
AAAAGGACGAUCCAUCGA--         U     C      -|       A   UUGCCAU 
                    GUUCUUACG AACUC UCAAAG GGCUGUGA AUG       \
                    UAAGGGUGC UUGAG AGUUUU CCGACACU UAC       U
AAAGACUGCCAAAAGACUGC         U     U      A^       A   UCAUCUA 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Star sequence

Dan-Mir-2-P4a_5p*

MirBase accessionNone
Sequence
0- CUCCUCAAAGGGCUGUGAAAUG -22
Get sequence
Mature sequence

Dan-Mir-2-P4a_3p

MirBase accessionMIMAT0008420
Sequence
39- UAUCACAGCCAUUUUGAUGAGUU -62
Get sequence