MirGeneDB

MirGeneDB ID

Dan-Mir-2-P3-v2

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-2c
Paralogues Dan-Mir-2-P1a-v1  Dan-Mir-2-P1a-v2  Dan-Mir-2-P1b-v1  Dan-Mir-2-P1b-v2  Dan-Mir-2-P2a-v1  Dan-Mir-2-P2a-v2  Dan-Mir-2-P2b  Dan-Mir-2-P3-v1  Dan-Mir-2-P4a  Dan-Mir-2-P4b1  Dan-Mir-2-P4b2  Dan-Mir-2-P5  Dan-Mir-2-P6a  Dan-Mir-2-P6b  Dan-Mir-2-P6c  Dan-Mir-2-P7  Dan-Mir-2-P8  Dan-Mir-2-P9 
Orthologues Dme-Mir-2-P3-v1  Dme-Mir-2-P3-v2  Dmo-Mir-2-P3  Dpu-Mir-2-o3 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13340: 12827849-12827913 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P3-v2)
Mir-2-P4b1 scaffold_13340: 12827487-12827547 [-] Ensembl
Mir-2-P4a scaffold_13340: 12827632-12827693 [-] Ensembl
Mir-2-P3-v1 scaffold_13340: 12827849-12827913 [-] Ensembl
Mir-2-P3-v2 scaffold_13340: 12827849-12827913 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GCGACGUAUCUACGAAUCUUACUUUCAAUGUCAUCAAAAAGGGCUGAAGAGAUAUUUCUGCAUUUGAAGUGUAUCACAGCCAGCUUUGAUGGGCAUUGCAAUAAGCCUAGAUUCCGAUUGAAACU
Get precursor sequence
Structure
        10           20        30         40        50        60   
GCGACGUAUCUACGAAU---|   C  U       -      AAG     AAGA     UUCUGCA 
                    CUUA UU CAAUGUC AUCAAA   GGCUG    GAUAU       \
                    GAAU AA GUUACGG UAGUUU   CCGAC    CUAUG       U
UCAAAGUUAGCCUUAGAUCC^   -  C       G      CGA     A---     UGAAGUU 
   120       110        100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Star sequence

Dan-Mir-2-P3-v2_5p*

MirBase accessionNone
Sequence
0- UCAUCAAAAAGGGCUGAAGAGAUAUU -26
Get sequence
Mature sequence

Dan-Mir-2-P3-v2_3p

MirBase accessionMIMAT0008442
Sequence
41- UAUCACAGCCAGCUUUGAUGGGCA -65
Get sequence