MirGeneDB

MirGeneDB ID

Dan-Mir-2-P2a-v1

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues Dan-Mir-2-P1a-v1  Dan-Mir-2-P1a-v2  Dan-Mir-2-P1b-v1  Dan-Mir-2-P1b-v2  Dan-Mir-2-P2a-v2  Dan-Mir-2-P2b  Dan-Mir-2-P3-v1  Dan-Mir-2-P3-v2  Dan-Mir-2-P4a  Dan-Mir-2-P4b1  Dan-Mir-2-P4b2  Dan-Mir-2-P5  Dan-Mir-2-P6a  Dan-Mir-2-P6b  Dan-Mir-2-P6c  Dan-Mir-2-P7  Dan-Mir-2-P8  Dan-Mir-2-P9 
Orthologues Dme-Mir-2-P2a  Dpu-Mir-2-o2 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_12916: 6006068-6006130 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GGAUACAGAUUUUUUUAGGGAACUGCGACCCUCCUUAAAGUGGCGGUGACAUGUAGCUUUCAUAUUCAUAUCACAGCUUUGCUUUCAGGAGCGUUGAGGUUUCUCGAAGCCAUCAAUAGUGAA
Get precursor sequence
Structure
        10          20        30        40          50          
GGAUACAGAUUUUUUUA--       G    C     U     --|  G    C   UAGCUU 
                   GGGAACU CGAC CUCCU AAAGU  GGC GUGA AUG      \
                   UCUUUGG GUUG GAGGA UUUCG  UCG CACU UAC      U
AAGUGAUAACUACCGAAGC       A    C     C     UU^  A    A   UUAUAC 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-2-P2a-v1_5p*

MirBase accessionNone
Sequence
0- CUCCUUAAAGUGGCGGUGACAUG -23
Get sequence
Mature sequence

Dan-Mir-2-P2a-v1_3p

MirBase accessionNone
Sequence
38- UAUCACAGCUUUGCUUUCAGGAGCG -63
Get sequence