MirGeneDB

MirGeneDB ID

Dan-Mir-2-P1b-v1

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-2a-2
Paralogues Dan-Mir-2-P1a-v1  Dan-Mir-2-P1a-v2  Dan-Mir-2-P1b-v2  Dan-Mir-2-P2a-v1  Dan-Mir-2-P2a-v2  Dan-Mir-2-P2b  Dan-Mir-2-P3-v1  Dan-Mir-2-P3-v2  Dan-Mir-2-P4a  Dan-Mir-2-P4b1  Dan-Mir-2-P4b2  Dan-Mir-2-P5  Dan-Mir-2-P6a  Dan-Mir-2-P6b  Dan-Mir-2-P6c  Dan-Mir-2-P7  Dan-Mir-2-P8  Dan-Mir-2-P9 
Orthologues Dme-Mir-2-P1b-v1  Dme-Mir-2-P1b-v2  Dmo-Mir-2-P1b-v1  Dmo-Mir-2-P1b-v2  Dpu-Mir-2-o1 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_12916: 12013993-12014052 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P1b-v1)
Mir-2-P2b scaffold_12916: 12013322-12013390 [+] Ensembl
Mir-2-P1a-v1 scaffold_12916: 12013671-12013735 [+] Ensembl
Mir-2-P1a-v2 scaffold_12916: 12013671-12013735 [+] Ensembl
Mir-2-P1b-v1 scaffold_12916: 12013993-12014052 [+] Ensembl
Mir-2-P1b-v2 scaffold_12916: 12013993-12014052 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UCUUCAUCGGCACGAUGUUGCUUAUCUAAGCCUCAUCAAGUGGUUGUGAUAUGGAUACCCAACGCAUAUCACAGCCAGCUUUGAUGAGCUAGGAUAAUCAACGGGAAACAACAUAAAUCU
Get precursor sequence
Structure
        10          20        30        40          50         
UCUUCAUCGGCACGAUG--   C      A  C         --|            GAUAC 
                   UUG UUAUCU AG CUCAUCAAG  UGGUUGUGAUAUG     \
                   AAC AAUAGG UC GAGUAGUUU  ACCGACACUAUAC     C
UCUAAAUACAACAAAGGGC   U      A  -         CG^            GCAAC 
.       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Star sequence

Dan-Mir-2-P1b-v1_5p*

MirBase accessionNone
Sequence
0- CCUCAUCAAGUGGUUGUGAUAUG -23
Get sequence
Mature sequence

Dan-Mir-2-P1b-v1_3p

MirBase accessionMIMAT0008414
Sequence
36- UAUCACAGCCAGCUUUGAUGAGCU -60
Get sequence