MirGeneDB

MirGeneDB ID

Dan-Mir-2-P1a-v1

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-2a-1
Paralogues Dan-Mir-2-P1a-v2  Dan-Mir-2-P1b-v1  Dan-Mir-2-P1b-v2  Dan-Mir-2-P2a-v1  Dan-Mir-2-P2a-v2  Dan-Mir-2-P2b  Dan-Mir-2-P3-v1  Dan-Mir-2-P3-v2  Dan-Mir-2-P4a  Dan-Mir-2-P4b1  Dan-Mir-2-P4b2  Dan-Mir-2-P5  Dan-Mir-2-P6a  Dan-Mir-2-P6b  Dan-Mir-2-P6c  Dan-Mir-2-P7  Dan-Mir-2-P8  Dan-Mir-2-P9 
Orthologues Dme-Mir-2-P1a-v1  Dme-Mir-2-P1a-v2  Dmo-Mir-2-P1a-v1  Dmo-Mir-2-P1a-v2  Dpu-Mir-2-o1 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_12916: 12013671-12013735 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P1a-v1)
Mir-2-P2b scaffold_12916: 12013322-12013390 [+] Ensembl
Mir-2-P1a-v1 scaffold_12916: 12013671-12013735 [+] Ensembl
Mir-2-P1a-v2 scaffold_12916: 12013671-12013735 [+] Ensembl
Mir-2-P1b-v1 scaffold_12916: 12013993-12014052 [+] Ensembl
Mir-2-P1b-v2 scaffold_12916: 12013993-12014052 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CAACAAAAAUAUUGGCACAUUCCUGCUGGGCUCACAAAGUGGUUGUGAAAUGCAUUUCCAUUUUGCCCGCAUAUCACAGCCAGCUUUGAUGAGCUUAGCGUUAUGUAUCGUACAUCAAUCAAUCA
Get precursor sequence
Structure
        10           20        30          40        50        60 
CAACAAAAAUAUUGGCA---   UCC           -     -|        A   CAUUUCCA 
                    CAU   UGCUGGGCUCA CAAAG UGGUUGUGA AUG        \
                    GUA   GCGAUUCGAGU GUUUC ACCGACACU UAC        U
ACUAACUAACUACAUGCUAU   UU-           A     G^        A   GCCCGUUU 
   120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-2-P1a-v1_5p*

MirBase accessionNone
Sequence
0- CUCACAAAGUGGUUGUGAAAUG -22
Get sequence
Mature sequence

Dan-Mir-2-P1a-v1_3p

MirBase accessionMIMAT0008414
Sequence
41- UAUCACAGCCAGCUUUGAUGAGCU -65
Get sequence