MirGeneDB

MirGeneDB ID

Dan-Mir-1014

Family name MIR-1014 (all species)
Seed UAUAAUG
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Dme-Mir-1014 
Node of Origin (locus) Drosophila melanogaster group
Node of Origin (family) Drosophila melanogaster group
Genome context
(Dana_caf1)
scaffold_12911: 3510633-3510700 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGUUCGUCCCUGCACUGGCAUUCUCCCAAGGUAUAAUGAAAAUUGAUUUUAAUCACACGGAUCGGAGUGGCAAAAUUAAAAUUCAUUUUCAUUUGCAGUCACGGGAUACAAUGUUCACCUCAUCAAUA
Get precursor sequence
Structure
        10        20        30           40        50        60    
UGUUCGUCCCUGCACUGGCAUUC    AAG---|  U         U         CACACGGAUC 
                       UCCC      GUA AAUGAAAAU GAUUUUAAU          \
                       AGGG      CGU UUACUUUUA UUAAAAUUA          G
AUAACUACUCCACUUGUAACAU-    CACUGA^  -         C         AAACGGUGAG 
      120       110        100         90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-1014_5p

MirBase accessionNone
Sequence
0- GUAUAAUGAAAAUUGAUUUUAAU -23
Get sequence
Co-mature sequence

Dan-Mir-1014_3p

MirBase accessionNone
Sequence
46- UAAAAUUCAUUUUCAUUUGCAG -68
Get sequence