MirGeneDB

MirGeneDB ID

Cpo-Mir-506-P2a

Family name MIR-506 (all species)
Seed CUGGCAC
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-507a
Paralogues Cpo-Mir-506-o1  Cpo-Mir-506-o2  Cpo-Mir-506-o3  Cpo-Mir-506-o4  Cpo-Mir-506-o5  Cpo-Mir-506-o6  Cpo-Mir-506-o7  Cpo-Mir-506-P1  Cpo-Mir-506-P2b  Cpo-Mir-506-P2c  Cpo-Mir-506-P6 
Orthologues Dno-Mir-506-P2  Hsa-Mir-506-P2  Mml-Mir-506-P2  Mmu-Mir-506-P2  Ocu-Mir-506-P2  Rno-Mir-506-P2 
Node of Origin (locus) C. porcellus
Node of Origin (family) Eutheria
Genome context
(cavPor3)
scaffold_84: 2762224-2762281 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-506-P2a)
Mir-506-o3 scaffold_84: 2752734-2752794 [+] UCSC
Mir-506-P2a scaffold_84: 2762224-2762281 [+] UCSC
Mir-506-P2b scaffold_84: 2763265-2763322 [+] UCSC
Mir-506-P2c scaffold_84: 2771646-2771702 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CCAUGUGCCGUUAGGCUUUGUGCGGUGCUUCACUCAAAAAGGUGCCAUUCAGGUAAAUUAAAAUAUGACUGGCACAUUUUUGAGUGCAGUAGUACACAACAUUUGCAGUAGUUUAAAC
Get precursor sequence
Structure
        10          20        30        40        50        
CCAUGUGCCGUUAGGCU--|    CGG    U          G      U  AGGUAAA 
                   UUGUG   UGCU CACUCAAAAA GUGCCA UC       U
                   AACAC   AUGA GUGAGUUUUU CACGGU AG       U
CAAAUUUGAUGACGUUUAC^    AUG    C          A      C  UAUAAAA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Cpo-Mir-506-P2a_5p*

MirBase accessionMIMAT0047315
Sequence
0- CACUCAAAAAGGUGCCAUUC -20
Get sequence
Mature sequence

Cpo-Mir-506-P2a_3p

MirBase accessionMIMAT0047316
Sequence
37- ACUGGCACAUUUUUGAGUGCA -58
Get sequence