MirGeneDB

MirGeneDB ID

Cpo-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-23a
Paralogues Cpo-Mir-23-P2 
Orthologues Aca-Mir-23-P1  Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Dno-Mir-23-P1  Dre-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Sto-Mir-23-o1  Sto-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(cavPor3)
scaffold_42: 12931646-12931703 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-23-P1)
Mir-23-P1 scaffold_42: 12931646-12931703 [+] UCSC
Mir-27-P1 scaffold_42: 12931848-12931908 [+] UCSC
Mir-24-P1 scaffold_42: 12931984-12932043 [+] UCSC
Precursor
(pre-Mir +30nt flank)
AGGGCCCCUGCCCCCGUGCCACGGUCAGCUGGGGUUCCUGGGGAUGGGAUUUGCUGUCUGUCACAAAUCACAUUGCCAGGGAUUUCCAACUGACCCUGAGCUCUGCCUCCAGGGCCAC
Get precursor sequence
Structure
        10         20        30         40        50        
AGGGCCCCUGCCCCCGUGC-  C      C   -|        G    G     GCUGU 
                    CA GGUCAG UGG GGUUCCUGG GAUG GAUUU     C
                    GU CCAGUC ACC UUAGGGACC UUAC CUAAA     U
CACCGGGACCUCCGUCUCGA  C      A   U^        G    A     CACUG 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cpo-Mir-23-P1_5p*

MirBase accessionMIMAT0046876
Sequence
0- GGGGUUCCUGGGGAUGGGAUUU -22
Get sequence
Mature sequence

Cpo-Mir-23-P1_3p

MirBase accessionMIMAT0046877
Sequence
36- AUCACAUUGCCAGGGAUUUCCA -58
Get sequence