MirGeneDB

MirGeneDB ID

Cpo-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-205
Paralogues
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(cavPor3)
scaffold_12: 13745521-13745577 [-] UCSC
Precursor
(pre-Mir +30nt flank)
AAGGUCCAGGACCAUCCACGGGUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUGCGGCAACCAGACUUCAGUGGAGUGAAGCUCAGGAGUCGUGGAGCUGCCGACGACAGUCACU
Get precursor sequence
Structure
        10             20        30        40        50        
AAGGUCCAGGACCAUCC-----|   GUU      UC           C        UCUGC 
                      ACGG   CUCUUG  CUUCAUUCCAC GGAGUCUG     \
                      UGCU   GAGGAC  GAAGUGAGGUG CUUCAGAC     G
UCACUGACAGCAGCCGUCGAGG^   ---      UC           A        CAACG 
     110       100           90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cpo-Mir-205-P1_5p

MirBase accessionMIMAT0047101
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Star sequence

Cpo-Mir-205-P1_3p*

MirBase accessionMIMAT0047102
Sequence
35- GACUUCAGUGGAGUGAAGCUCA -57
Get sequence