MirGeneDB

MirGeneDB ID

Cpo-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-19b-2
Paralogues Cpo-Mir-19-P1  Cpo-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(cavPor3)
scaffold_128: 2512548-2512615 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b scaffold_128: 2512251-2512315 [-] UCSC
Mir-92-P1b scaffold_128: 2512411-2512471 [-] UCSC
Mir-19-P2b scaffold_128: 2512548-2512615 [-] UCSC
Mir-17-P3b scaffold_128: 2512679-2512739 [-] UCSC
Mir-17-P2b scaffold_128: 2512897-2512961 [-] UCSC
Mir-17-P1b scaffold_128: 2513060-2513118 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GAGUAUUCAAGGACACUGCUACUUACAAUUAGUUUUGCAGGUUUGCAUUUCAGCGUAUAGAUAUAUCUACAUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGAUAAUGUGUGCUUUCUACACCUUUG
Get precursor sequence
Structure
        10        20          30         40         50        60    
GAGUAUUCAAGGACACUGCUAC--                 -  -|     UUU    GUAUAGAUA 
                        UUACAAUUAGUUUUGCA GG UUUGCA   CAGC         \
                        AGUGUUAGUCAAAACGU CC AAACGU   GUCG         U
GUUUCCACAUCUUUCGUGUGUAAU                 A  U^     ---    GUACAUCUA 
      120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Star sequence

Cpo-Mir-19-P2b_5p* (predicted)

MirBase accessionMIMAT0046867
Sequence
0- AGUUUUGCAGGUUUGCAUUUCAGC -24
Get sequence
Mature sequence

Cpo-Mir-19-P2b_3p

MirBase accessionMIMAT0046866
Sequence
45- UGUGCAAAUCCAUGCAAAACUGA -68
Get sequence