MirGeneDB

MirGeneDB ID

Cpo-Mir-17-P3c

Family name MIR-17 (all species)
Seed AAAGUGC
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-106b
Paralogues Cpo-Mir-17-P1a  Cpo-Mir-17-P1b  Cpo-Mir-17-P1c  Cpo-Mir-17-P2a  Cpo-Mir-17-P2b  Cpo-Mir-17-P3a  Cpo-Mir-17-P3b 
Orthologues Ami-Mir-17-P3c  Bta-Mir-17-P3c  Cfa-Mir-17-P3c  Cpi-Mir-17-P3c  Dno-Mir-17-P3c  Ete-Mir-17-P3c  Hsa-Mir-17-P3c  Mml-Mir-17-P3c  Mmu-Mir-17-P3c  Ocu-Mir-17-P3c  Rno-Mir-17-P3c  Sto-Mir-17-P3c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(cavPor3)
scaffold_30: 4035937-4035998 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-17-P3c)
Mir-17-P3c scaffold_30: 4035937-4035998 [+] UCSC
Mir-17-P1c scaffold_30: 4036154-4036215 [+] UCSC
Mir-92-P2c scaffold_30: 4036356-4036415 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CCACCUCCCUCUCACUGGCCCUGCCGGGGCUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCUCUGUGCUACCGCACUGUGGGUACUUGCUGCUCCAGCAGGGCAUGCACAGCGCCCAUGGAG
Get precursor sequence
Structure
        10          20        30         40        50          
CCACCUCCCUCUCACUG--       C     UA-|      G       AGAUAGUGGUCC 
                   GCCCUGC GGGGC   AAGUGCU ACAGUGC            \
                   CGGGACG CCUCG   UUCAUGG UGUCACG            U
GAGGUACCCGCGACACGUA       A     UCG^      G       CCAUCGUGUCUC 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere are Dicer sites +1 and +2 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Cpo-Mir-17-P3c_5p

MirBase accessionMIMAT0046957
Sequence
0- UAAAGUGCUGACAGUGCAGAUA -22
Get sequence
Co-mature sequence

Cpo-Mir-17-P3c_3p

MirBase accessionMIMAT0046958
Sequence
40- CCGCACUGUGGGUACUUGCUGC -62
Get sequence