MirGeneDB

MirGeneDB ID

Cpi-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-23a
Paralogues Cpi-Mir-23-P2 
Orthologues Aca-Mir-23-P1  Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpo-Mir-23-P1  Dno-Mir-23-P1  Dre-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Sto-Mir-23-o1  Sto-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(chrPic1)
JH584948: 868694-868754 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-23-P1)
Mir-24-P1 JH584948: 868114-868173 [-] UCSC
Mir-27-P1 JH584948: 868327-868390 [-] UCSC
Mir-23-P1 JH584948: 868694-868754 [-] UCSC
Precursor
(pre-Mir +30nt flank)
CCAUGCCGGCUUCUCCUGCCCCUGCCAGCUGGGGUUCCUGGUGAUGCGAUUUUUAUCCUACCACCCAAAAUCACAUUGCCAGGGAUUUCCAACGGGCGGCGGGCCACAGCGCCCAGGAGAC
Get precursor sequence
Structure
        10        20         30         40        50          
CCAUGCCGGCUUCUCCUG   -     AGC   -|        UG   C     UUAUCCU 
                  CCC CUGCC   UGG GGUUCCUGG  AUG GAUUU       \
                  GGG GGCGG   ACC UUAGGGACC  UAC CUAAA       A
CAGAGGACCCGCGACACC   C     GCA   U^        GU   A     ACCCACC 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Te Te Te To
Star sequence

Cpi-Mir-23-P1_5p*

MirBase accessionNone
Sequence
0- GGGGUUCCUGGUGAUGCGAUUU -22
Get sequence
Mature sequence

Cpi-Mir-23-P1_3p

MirBase accessionMIMAT0037655
Sequence
39- AUCACAUUGCCAGGGAUUUCCA -61
Get sequence