MirGeneDB

MirGeneDB ID

Cpi-Mir-219-P1

Family name MIR-219 (all species)
Seed GAUUGUC
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-219-1
Paralogues Cpi-Mir-219-P2 
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Ami-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dpu-Mir-219  Dre-Mir-219-P1a  Ete-Mir-219-P1  Hsa-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mml-Mir-219-P1  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sha-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Tca-Mir-219 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(chrPic1)
JH584591: 148663-148719 [+] UCSC
Precursor
(pre-Mir +30nt flank)
UGCCCACGGCCUGCACUGAACACCGGCUCCUGAUUGUCCAAACGCAAUUCUUGUGUCUGCGCCCAAGAAUUGAGUGUGGACGUCGUGAGCCGGGGUUUCCUAUCGACGCCUGGCGGA
Get precursor sequence
Structure
        10          20        30        40        50        
UGCCCACGGCCUGCACU--|   A       C    U     A  G         UGUC 
                   GAAC CCGGCUC UGAU GUCCA AC CAAUUCUUG    U
                   UUUG GGCCGAG GCUG CAGGU UG GUUAAGAAC    G
AGGCGGUCCGCAGCUAUCC^   G       U    -     G  A         CCGC 
     110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Te Te Te To
Mature sequence

Cpi-Mir-219-P1_5p

MirBase accessionMIMAT0037848
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Co-mature sequence

Cpi-Mir-219-P1_3p

MirBase accessionNone
Sequence
35- AGAAUUGAGUGUGGACGUCGUG -57
Get sequence