MirGeneDB

MirGeneDB ID

Cpi-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-19b-2
Paralogues Cpi-Mir-19-P1  Cpi-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(chrPic1)
JH584720: 2634792-2634851 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-17-P1b JH584720: 2634299-2634357 [+] UCSC
Mir-17-P2b JH584720: 2634454-2634518 [+] UCSC
Mir-17-P3b JH584720: 2634668-2634729 [+] UCSC
Mir-19-P2b JH584720: 2634792-2634851 [+] UCSC
Mir-92-P1b JH584720: 2634933-2634994 [+] UCSC
Mir-92-P2b JH584720: 2635069-2635133 [+] UCSC
Precursor
(pre-Mir +30nt flank)
UGUCCUGAAAAGAUAGUGCUGACUACAGUCAGUUUUGCAGGAUUGCAUUCCAGCUUAUUUCAAACGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUUGCAUUCAUUCGGUUGCGAGGUA
Get precursor sequence
Structure
        10           20        30         40         50          
UGUCCUGAAAAGAUAGU---  U                   -   -|    UUC    UUAUU 
                    GC GACUACAGUCAGUUUUGCA GGA UUGCA   CAGC     \
                    CG UUGGUGUCAGUCAAAACGU CCU AACGU   GUCG     U
AUGGAGCGUUGGCUUACUUA  -                   A   A^    ---    CAAAC 
.       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Te Te Te To
Star sequence

Cpi-Mir-19-P2b_5p*

MirBase accessionMIMAT0037646
Sequence
0- AGUUUUGCAGGAUUGCAUUCCAGC -24
Get sequence
Mature sequence

Cpi-Mir-19-P2b_3p

MirBase accessionMIMAT0037645
Sequence
37- UGUGCAAAUCCAUGCAAAACUGA -60
Get sequence