MirGeneDB

MirGeneDB ID

Cli-Mir-92-P2b

Family name MIR-92 (all species)
Seed AUUGCAC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-363
Paralogues Cli-Mir-92-P1a  Cli-Mir-92-P1b  Cli-Mir-92-P2a 
Orthologues Aca-Mir-92-P2b  Asu-Mir-92  Bfl-Mir-92-o2b  Bta-Mir-92-P2b  Cel-Mir-92  Cfa-Mir-92-P2b  Cpi-Mir-92-P2b  Cpo-Mir-92-P2b  Dno-Mir-92-P2b  Dre-Mir-92-P2b1  Ete-Mir-92-P2b  Gga-Mir-92-P2b  Hsa-Mir-92-P2b  Isc-Mir-92  Mdo-Mir-92-P2b  Mml-Mir-92-P2b  Mmu-Mir-92-P2b  Oan-Mir-92-P2b  Ocu-Mir-92-P2b  Rno-Mir-92-P2b  Sha-Mir-92-P2b  Sto-Mir-92-P2b  Tgu-Mir-92-P2b  Xtr-Mir-92-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold72: 3451682-3451746 [-]
Clustered MiRNAs
(< 10kb from Mir-92-P2b)
Mir-92-P2b scaffold72: 3451682-3451746 [-]
Mir-92-P1b scaffold72: 3451822-3451883 [-]
Mir-19-P2b scaffold72: 3451991-3452050 [-]
Mir-17-P3b scaffold72: 3452115-3452175 [-]
Mir-17-P2b scaffold72: 3452309-3452373 [-]
Mir-17-P1b scaffold72: 3452469-3452526 [-]
Precursor
(pre-Mir +30nt flank)
CCAGUAUGGUAAGCUUUGUUUUGCUGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUUAGUUUAGUAGGAGAAAAAUUGCACGGUAUCCAUCUGUAAACCGCAAGACCUUCAUCGCUGACAACUUA
Get precursor sequence
Structure
        10          20        30        40        50        60  
CCAGUAUGGUAAGCUUU--|      U   GU         CA  A         GAUUAGUU 
                   GUUUUGC GUU  CGGGUGGAU  CG UGCAAUUUU        U
                   CAGAACG CAA  GUCUACCUA  GC ACGUUAAAA        A
AUUCAACAGUCGCUACUUC^      C   AU         UG  -         AGAGGAUG 
   120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Star sequence

Cli-Mir-92-P2b_5p*

MirBase accessionMIMAT0038622
Sequence
0- CGGGUGGAUCACGAUGCAAUUUU -23
Get sequence
Mature sequence

Cli-Mir-92-P2b_3p

MirBase accessionMIMAT0038623
Sequence
43- AAUUGCACGGUAUCCAUCUGUA -65
Get sequence