MirGeneDB

MirGeneDB ID

Cli-Mir-92-P1b

Family name MIR-92 (all species)
Seed AUUGCAC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-92-2
Paralogues Cli-Mir-92-P1a  Cli-Mir-92-P2a  Cli-Mir-92-P2b 
Orthologues Aca-Mir-92-P1b  Asu-Mir-92  Bfl-Mir-92-o1  Bta-Mir-92-P1b  Cel-Mir-92  Cfa-Mir-92-P1b  Cpi-Mir-92-P1b  Cpo-Mir-92-P1b  Dno-Mir-92-P1b  Ete-Mir-92-P1b  Gga-Mir-92-P1b  Hsa-Mir-92-P1b  Isc-Mir-92  Mdo-Mir-92-P1b  Mml-Mir-92-P1b  Mmu-Mir-92-P1b  Oan-Mir-92-P1b  Ocu-Mir-92-P1b  Rno-Mir-92-P1b  Sha-Mir-92-P1b  Sto-Mir-92-P1b  Tgu-Mir-92-P1b  Xtr-Mir-92-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold72: 3451822-3451883 [-]
Clustered MiRNAs
(< 10kb from Mir-92-P1b)
Mir-92-P2b scaffold72: 3451682-3451746 [-]
Mir-92-P1b scaffold72: 3451822-3451883 [-]
Mir-19-P2b scaffold72: 3451991-3452050 [-]
Mir-17-P3b scaffold72: 3452115-3452175 [-]
Mir-17-P2b scaffold72: 3452309-3452373 [-]
Mir-17-P1b scaffold72: 3452469-3452526 [-]
Precursor
(pre-Mir +30nt flank)
UCUCAAGAUGCCUUGCGCUGGUUUCUCCAUGGGUGGGGAUUUGUUGCAUUACUUGUAGCUGUAUGUAGAGUAUUGCACUUGUCCCGGCCUGUGGAGGAAAUGAGGACUUGUCUUCAGGCUGC
Get precursor sequence
Structure
        10         20         30        40        50        60 
UCUCAAGAUGCCUUGCG-  G    -|         G     UU  U   U    UGUAGCU 
                  CU GUUU CUCCAUGGGU GGGAU  GU GCA UACU       \
                  GA UAAA GAGGUGUCCG CCCUG  CA CGU AUGA       G
CGUCGGACUUCUGUUCAG  G    G^         G     UU  -   U    GAUGUAU 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site on the 5p arm +2 relative as well as a second Dicer site +1 on the 5p arm relative to what is annotated here.
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Star sequence

Cli-Mir-92-P1b_5p*

MirBase accessionMIMAT0038475
Sequence
0- GGGUGGGGAUUUGUUGCAUUACU -23
Get sequence
Mature sequence

Cli-Mir-92-P1b_3p

MirBase accessionMIMAT0038474
Sequence
40- UAUUGCACUUGUCCCGGCCUGU -62
Get sequence