MirGeneDB

MirGeneDB ID

Cli-Mir-33-P2

Family name MIR-33 (all species)
Seed UGCAUUG
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-33-2
Paralogues Cli-Mir-33-P1 
Orthologues Aae-Mir-33  Aca-Mir-33-P2  Ami-Mir-33-P2  Bge-Mir-33  Bta-Mir-33-P2  Cfa-Mir-33-P2  Cgi-Mir-33  Cin-Mir-33  Cpi-Mir-33-P2  Cpo-Mir-33-P2  Cte-Mir-33  Dan-Mir-33  Dme-Mir-33  Dmo-Mir-33  Dno-Mir-33-P2  Dpu-Mir-33  Dre-Mir-33-P2  Efe-Mir-33  Ete-Mir-33-P2  Gga-Mir-33-P2  Hsa-Mir-33-P2  Isc-Mir-33  Lgi-Mir-33  Mml-Mir-33-P2  Oan-Mir-33-P2  Ocu-Mir-33-P2  Pfl-Mir-33  Pmi-Mir-33  Sko-Mir-33  Spu-Mir-33  Sto-Mir-33-P2  Tca-Mir-33  Xtr-Mir-33-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold146: 1338945-1339004 [+]
Precursor
(pre-Mir +30nt flank)
UCGCGGGAGGUGCCCCCGGCCCUCGCGGGGGUGCAUUGUAGUUGCAUUGCAUGUGUCAGACUGGGAGUGCAAUGCCCCUGCCAUGCAGCCCGGCGGGGGCCCCGUGCAGCAACGCCUGCC
Get precursor sequence
Structure
        10          20        30        40        50         
UCGCGGGAGGUGCCCCC--|        G   G     U    UU        UGUGUCA 
                   GGCCCUCGC GGG UGCAU GUAG  GCAUUGCA       G
                   CCGGGGGCG CCC ACGUA CGUC  CGUAACGU       A
CCGUCCGCAACGACGUGCC^        G   G     C    CC        GAGGGUC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Cli-Mir-33-P2_5p

MirBase accessionMIMAT0038464
Sequence
0- GUGCAUUGUAGUUGCAUUGCA -21
Get sequence
Star sequence

Cli-Mir-33-P2_3p*

MirBase accessionMIMAT0038466
Sequence
39- CAAUGCCCCUGCCAUGCAGCC -60
Get sequence