MirGeneDB

MirGeneDB ID

Cli-Mir-30-P1c

Family name MIR-30 (all species)
Seed GUAAACA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-30d
Paralogues Cli-Mir-30-P1a  Cli-Mir-30-P1b  Cli-Mir-30-P2a  Cli-Mir-30-P2b 
Orthologues Aca-Mir-30-P1c  Ami-Mir-30-P1c  Bta-Mir-30-P1c  Cfa-Mir-30-P1c  Cpi-Mir-30-P1c  Cpo-Mir-30-P1c  Dno-Mir-30-P1c  Dre-Mir-30-P1c  Ete-Mir-30-P1c  Gga-Mir-30-P1c  Hsa-Mir-30-P1c  Mdo-Mir-30-P1c  Mml-Mir-30-P1c  Mmu-Mir-30-P1c  Oan-Mir-30-P1c  Ocu-Mir-30-P1c  Rno-Mir-30-P1c  Sha-Mir-30-P1c  Sto-Mir-30-P1c  Tgu-Mir-30-P1c  Xtr-Mir-30-P1c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold419: 3168635-3168692 [-]
Precursor
(pre-Mir +30nt flank)
CGCUGGCGCUGACGUGCCGUGGUCCGGUGCUGUAAACAUCCCCGACUGGAAGCUGUUCCCGUCCAGCUUUCAGUCAGAUGUUUGCUGCACCUGGCUGCGCUCGGACAACUGCAGAAGG
Get precursor sequence
Structure
        10          20        30        40        50         
CGCUGGCGCUGACGUGC--| UG   C     U         CCC           GUUC 
                   CG  GUC GGUGC GUAAACAUC   GACUGGAAGCU    C
                   GC  CGG CCACG CGUUUGUAG   CUGACUUUCGA    C
GGAAGACGUCAACAGGCUC^ GU   U     U         A--           CCUG 
      110       100        90        80          70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-30-P1c_5p

MirBase accessionMIMAT0038456
Sequence
0- UGUAAACAUCCCCGACUGGAAGCU -24
Get sequence
Star sequence

Cli-Mir-30-P1c_3p*

MirBase accessionMIMAT0038457
Sequence
36- CUUUCAGUCAGAUGUUUGCUGC -58
Get sequence