MirGeneDB

MirGeneDB ID

Cli-Mir-22-P1a

Family name MIR-22 (all species)
Seed AGCUGCC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-22
Paralogues
Orthologues Aca-Mir-22-P1a  Bfl-Mir-22-P1  Bta-Mir-22-P1a  Cfa-Mir-22-P1a  Cgi-Mir-22-P1  Cpi-Mir-22-P1a  Cpo-Mir-22-P1a  Cte-Mir-22-P1  Dno-Mir-22-P1a  Dre-Mir-22-P1a  Ete-Mir-22-P1a  Gga-Mir-22-P1a  Hsa-Mir-22-P1a  Lan-Mir-22-P1  Lgi-Mir-22-P1  Mdo-Mir-22-P1a  Mml-Mir-22-P1a  Mmu-Mir-22-P1a  Oan-Mir-22-P1a  Ocu-Mir-22-P1a  Pfl-Mir-22-P1  Pmi-Mir-22-P1  Rno-Mir-22-P1a  Sha-Mir-22-P1a  Sto-Mir-22-P1a  Xtr-Mir-22-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold94: 2621552-2621614 [-]
Precursor
(pre-Mir +30nt flank)
CUGCCGCCCUGCUCCUGGCUAACCAGCACCAGUUCUUCAGUGGCAAGCUUUAUGUCCUUCUCUAGUAGCUAAAGCUGCCAGUUGAAGAACUGUUGAAUGUAGCCACUCGCUUCUCGUCACCGG
Get precursor sequence
Structure
        10           20        30        40         50        60 
CUGCCGCCCUGCUCCUG---|   ACCAG  C           -     A      UGUCCUUC 
                    GCUA     CA CAGUUCUUCAG UGGCA GCUUUA        \
                    CGAU     GU GUCAAGAAGUU ACCGU CGAAAU        U
GGCCACUGCUCUUCGCUCAC^   GUAA-  U           G     -      CGAUGAUC 
 120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Cli-Mir-22-P1a_5p*

MirBase accessionMIMAT0038438
Sequence
0- AGUUCUUCAGUGGCAAGCUUUA -22
Get sequence
Mature sequence

Cli-Mir-22-P1a_3p

MirBase accessionMIMAT0038439
Sequence
41- AAGCUGCCAGUUGAAGAACUGU -63
Get sequence