MirGeneDB

MirGeneDB ID

Cli-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-205a
Paralogues Cli-Mir-205-P2 
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold454: 2679550-2679609 [+]
Precursor
(pre-Mir +30nt flank)
UGGAAUCAGGACAAUCCAUGGGUUCUGUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCUAAACCAGAUUUCAGUGGAGUGAAGUACGAGAGACAUGGAGAUGAAUCAGCAAGGAGAG
Get precursor sequence
Structure
        10        20          30        40        50         
UGGAAUCAGGACAAUCCAUGGGU--|  G    C           C        UCUCAU 
                         UCU UUGU CUUCAUUCCAC GGAGUCUG      A
                         AGA AGCA GAAGUGAGGUG CUUUAGAC      C
GAGAGGAACGACUAAGUAGAGGUAC^  G    U           A        CAAAUC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Cli-Mir-205-P1_5p

MirBase accessionMIMAT0038584
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Star sequence

Cli-Mir-205-P1_3p*

MirBase accessionMIMAT0038585
Sequence
38- GAUUUCAGUGGAGUGAAGUACG -60
Get sequence