MirGeneDB

MirGeneDB ID

Cli-Mir-204-P3

Family name MIR-204 (all species)
Seed UCCCUUU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-204-3
Paralogues Cli-Mir-204-P1  Cli-Mir-204-P2 
Orthologues Ami-Mir-204-P3  Cpi-Mir-204-P3  Gga-Mir-204-P3  Sto-Mir-204-P3  Tgu-Mir-204-P3a  Tgu-Mir-204-P3b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold194: 1274466-1274522 [+]
Precursor
(pre-Mir +30nt flank)
GAGGGCCCGCGGCCCCUGCCCCCUGUGAGCUUCCCUUUGUCAUCCUAUGCCUGAGCCAUGGCCGAGGCUGGGACGGUGAAGGGAGGCCCACGGGCUGCCACAGCCCCGAUGCCACGG
Get precursor sequence
Structure
        10          20        30        40        50        
GAGGGCCCGCGGCCCCU--| CC      A         UG  A     U    GAGCC 
                   GC  CCUGUG GCUUCCCUU  UC UCCUA GCCU     A
                   CG  GGGCAC CGGAGGGAA  GG AGGGU CGGA     U
GGCACCGUAGCCCCGACAC^ UC      C         GU  C     -    GCCGG 
     110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-204-P3_5p

MirBase accessionMIMAT0038580
Sequence
0- UUCCCUUUGUCAUCCUAUGCCU -22
Get sequence
Star sequence

Cli-Mir-204-P3_3p*

MirBase accessionMIMAT0038583
Sequence
36- GCUGGGACGGUGAAGGGAGGC -57
Get sequence