MirGeneDB

MirGeneDB ID

Cli-Mir-17-P3b

Family name MIR-17 (all species)
Seed AAAGUGC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-20b
Paralogues Cli-Mir-17-P1a  Cli-Mir-17-P1b  Cli-Mir-17-P2a  Cli-Mir-17-P2b  Cli-Mir-17-P3a 
Orthologues Aca-Mir-17-P3b  Bta-Mir-17-P3b  Cfa-Mir-17-P3b  Cpi-Mir-17-P3b  Cpo-Mir-17-P3b  Dno-Mir-17-P3b  Dre-Mir-17-P3b1  Ete-Mir-17-P3b  Gga-Mir-17-P3b  Hsa-Mir-17-P3b  Mdo-Mir-17-P3b  Mml-Mir-17-P3b  Mmu-Mir-17-P3b  Oan-Mir-17-P3b  Ocu-Mir-17-P3b  Rno-Mir-17-P3b  Sha-Mir-17-P3b  Tgu-Mir-17-P3b  Xtr-Mir-17-P3b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold72: 3452115-3452175 [-]
Clustered MiRNAs
(< 10kb from Mir-17-P3b)
Mir-92-P2b scaffold72: 3451682-3451746 [-]
Mir-92-P1b scaffold72: 3451822-3451883 [-]
Mir-19-P2b scaffold72: 3451991-3452050 [-]
Mir-17-P3b scaffold72: 3452115-3452175 [-]
Mir-17-P2b scaffold72: 3452309-3452373 [-]
Mir-17-P1b scaffold72: 3452469-3452526 [-]
Precursor
(pre-Mir +30nt flank)
UCUCGGGAAGUAGUUUUGUCCUAGCAGUAUCAAAGUGCUCAUAGUGCAGGUAGCUUUGAAUUGAACCUACUGUAAUGUGGGCACUUAUAGUACUGCUAGAUAAAGUGCAUCCCAGCUAGUG
Get precursor sequence
Structure
        10        20          30         40        50          
UCUCGGGAAGUAGUUUUGUC--          CA-|          G     G   CUUUGA 
                      CUAGCAGUAU   AAGUGCUCAUA UGCAG UAG      \
                      GAUCGUCAUG   UUCACGGGUGU AUGUC AUC      A
GUGAUCGACCCUACGUGAAAUA          AUA^          A     -   CAAGUU 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-17-P3b_5p

MirBase accessionMIMAT0038434
Sequence
0- CAAAGUGCUCAUAGUGCAGGUAG -23
Get sequence
Star sequence

Cli-Mir-17-P3b_3p*

MirBase accessionMIMAT0038435
Sequence
38- ACUGUAAUGUGGGCACUUAUAGU -61
Get sequence