MirGeneDB

MirGeneDB ID

Cli-Mir-17-P2b

Family name MIR-17 (all species)
Seed AAGGUGC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-18b
Paralogues Cli-Mir-17-P1a  Cli-Mir-17-P1b  Cli-Mir-17-P2a  Cli-Mir-17-P3a  Cli-Mir-17-P3b 
Orthologues Aca-Mir-17-P2b  Bta-Mir-17-P2b  Cfa-Mir-17-P2b  Cpi-Mir-17-P2b  Cpo-Mir-17-P2b  Dno-Mir-17-P2b  Dre-Mir-17-P2b1  Ete-Mir-17-P2b  Gga-Mir-17-P2b  Hsa-Mir-17-P2b  Mdo-Mir-17-P2b  Mml-Mir-17-P2b  Mmu-Mir-17-P2b  Oan-Mir-17-P2b  Ocu-Mir-17-P2b  Rno-Mir-17-P2b  Sha-Mir-17-P2b  Sto-Mir-17-P2b  Tgu-Mir-17-P2b  Xtr-Mir-17-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold72: 3452309-3452373 [-]
Clustered MiRNAs
(< 10kb from Mir-17-P2b)
Mir-92-P2b scaffold72: 3451682-3451746 [-]
Mir-92-P1b scaffold72: 3451822-3451883 [-]
Mir-19-P2b scaffold72: 3451991-3452050 [-]
Mir-17-P3b scaffold72: 3452115-3452175 [-]
Mir-17-P2b scaffold72: 3452309-3452373 [-]
Mir-17-P1b scaffold72: 3452469-3452526 [-]
Precursor
(pre-Mir +30nt flank)
UUGGAGCUGCCUUACAAAUGGUUCUUGUGUUAAGGUGCAUCUAGUGCAGUUAGUGAAGUAGCGUAGAAUCUACUGCCCUAAAUGCUCCUUCUGGCACAAGCUGCUGCCUGCACGUCCAAAAAGAA
Get precursor sequence
Structure
        10         20         30          40        50        60 
UUGGAGCUGCCUUACAAAU-   U-         --|  U    C   U     UAGUGAAGUA 
                    GGU  CUUGUGUUA  AGG GCAU UAG GCAGU          \
                    UCG  GAACACGGU  UCC CGUA AUC CGUCA          G
AAGAAAAACCUGCACGUCCG   UC         CU^  U    A   C     UCUAAGAUGC 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-17-P2b_5p

MirBase accessionMIMAT0038425
Sequence
0- UAAGGUGCAUCUAGUGCAGU -20
Get sequence
Star sequence

Cli-Mir-17-P2b_3p*

MirBase accessionMIMAT0038426
Sequence
43- UGCCCUAAAUGCUCCUUCUGGC -65
Get sequence