MirGeneDB

MirGeneDB ID

Cli-Mir-17-P1b

Family name MIR-17 (all species)
Seed AAAGUGC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-106
Paralogues Cli-Mir-17-P1a  Cli-Mir-17-P2a  Cli-Mir-17-P2b  Cli-Mir-17-P3a  Cli-Mir-17-P3b 
Orthologues Aca-Mir-17-P1b  Bta-Mir-17-P1b  Cfa-Mir-17-P1b  Cpi-Mir-17-P1b  Cpo-Mir-17-P1b  Dno-Mir-17-P1b  Ete-Mir-17-P1b  Gga-Mir-17-P1b  Hsa-Mir-17-P1b  Mdo-Mir-17-P1b  Mml-Mir-17-P1b  Mmu-Mir-17-P1b  Oan-Mir-17-P1b  Ocu-Mir-17-P1b  Rno-Mir-17-P1b  Sha-Mir-17-P1b  Tgu-Mir-17-P1b  Xtr-Mir-17-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold72: 3452469-3452526 [-]
Clustered MiRNAs
(< 10kb from Mir-17-P1b)
Mir-92-P2b scaffold72: 3451682-3451746 [-]
Mir-92-P1b scaffold72: 3451822-3451883 [-]
Mir-19-P2b scaffold72: 3451991-3452050 [-]
Mir-17-P3b scaffold72: 3452115-3452175 [-]
Mir-17-P2b scaffold72: 3452309-3452373 [-]
Mir-17-P1b scaffold72: 3452469-3452526 [-]
Precursor
(pre-Mir +30nt flank)
AAAAGUUUGGUGAUGGGCCUUGAGUUGUGCAAAAGUGCUUACAGUGCAGGUAGAGUUUAGGAUCUACUGCAGUAUAAGCACUUCUGGCAUUACUGUGGCGAUUUAGUGACGGUGGUGG
Get precursor sequence
Structure
        10           20        30         40        50        
AAAAGUUUGGUGAUGGG---| UUG   U    AA-         CAG     G   AGUU 
                    CC   AGU GUGC   AAGUGCUUA   UGCAG UAG    U
                    GG   UCA UACG   UUCACGAAU   ACGUC AUC    A
GGUGGUGGCAGUGAUUUAGC^ UG-   U    GUC         AUG     -   UAGG 
      110       100         90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Cli-Mir-17-P1b_5p

MirBase accessionMIMAT0038487
Sequence
0- AAAAGUGCUUACAGUGCAGGUAG -23
Get sequence
Star sequence

Cli-Mir-17-P1b_3p*

MirBase accessionMIMAT0038488
Sequence
35- ACUGCAGUAUAAGCACUUCUGGC -58
Get sequence