MirGeneDB

MirGeneDB ID

Cli-Mir-146-P3

Family name MIR-146 (all species)
Seed GAGAACU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-146c
Paralogues Cli-Mir-146-P1  Cli-Mir-146-P2 
Orthologues Aca-Mir-146-P3  Ami-Mir-146-P3  Cpi-Mir-146-P3  Gga-Mir-146-P3  Sto-Mir-146-P3  Tgu-Mir-146-P3  Xtr-Mir-146-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold203: 1412190-1412255 [-]
Precursor
(pre-Mir +30nt flank)
AGAUGUGAUGAAUUUGGCAGUUCCCAGCUCUGAGAACUGAAUUCCAUGGACUGGUUCCAGUUCCAUGUGUUCAGUCCAUGGUAUUCAGUUCUCUAGCUUGGCUGCAUCGAACUUCACGACUGCGAA
Get precursor sequence
Structure
        10          20         30        40        50        60  
AGAUGUGAUGAAUUUGGCA--  UC  -|   CU           U          GUUCCAGU 
                     GU  CC AGCU  GAGAACUGAAU CCAUGGACUG        U
                     CG  GG UCGA  CUCUUGACUUA GGUACCUGAC        C
AAGCGUCAGCACUUCAAGCUA  UC  U^   U-           U          UUGUGUAC 
    120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-146-P3_5p

MirBase accessionMIMAT0038539
Sequence
0- UGAGAACUGAAUUCCAUGGACUG -23
Get sequence
Star sequence

Cli-Mir-146-P3_3p*

MirBase accessionMIMAT0038540
Sequence
43- GUCCAUGGUAUUCAGUUCUCUAG -66
Get sequence