MirGeneDB

MirGeneDB ID

Cli-Mir-142-P3-v2

Family name MIR-142 (all species)
Seed UAGUGUU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-142
Paralogues Cli-Mir-142-P3-v1  Cli-Mir-142-P3-v3  Cli-Mir-142-P3-v4 
Orthologues Ami-Mir-142-P3-v1  Ami-Mir-142-P3-v2  Ami-Mir-142-P3-v3  Ami-Mir-142-P3-v4  Cpi-Mir-142-P3-v1  Cpi-Mir-142-P3-v2  Cpi-Mir-142-P3-v3  Cpi-Mir-142-P3-v4  Gga-Mir-142-P3-v1  Gga-Mir-142-P3-v2  Gga-Mir-142-P3-v3  Gga-Mir-142-P3-v4  Tgu-Mir-142-P3-v1  Tgu-Mir-142-P3-v2  Tgu-Mir-142-P3-v3  Tgu-Mir-142-P3-v4 
Node of Origin (locus) Diapsida
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold281: 47104-47163 [+]
Clustered MiRNAs
(< 10kb from Mir-142-P3-v2)
Mir-142-P3-v4 scaffold281: 47102-47165 [+]
Mir-142-P3-v1 scaffold281: 47104-47163 [+]
Mir-142-P3-v2 scaffold281: 47104-47163 [+]
Mir-142-P3-v3 scaffold281: 47104-47163 [+]
Precursor
(pre-Mir +30nt flank)
GGACACCGACUGAGAGACAGUGCAGUCACCCAUAAAGUAGAAAGCACUACUAAACAGCACUGCAGGGUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGUGGGCUACGGAGAAGAGAG
Get precursor sequence
Structure
        10          20        30        40        50         
GGACACCGACUGAGAGA--|      G   C           A         UAAACAGC 
                   CAGUGCA UCA CCAUAAAGUAG AAGCACUAC        A
                   GUCAUGU AGU GGUAUUUCAUC UUUGUGAUG        C
GAGAGAAGAGGCAUCGGGU^      G   A           C         UGGGACGU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cli-Mir-142-P3-v2_5p*

MirBase accessionMIMAT0038529
Sequence
0- CAUAAAGUAGAAAGCACUACUA -22
Get sequence
Mature sequence

Cli-Mir-142-P3-v2_3p

MirBase accessionMIMAT0038530
Sequence
38- GUAGUGUUUCCUACUUUAUGGA -60
Get sequence