MirGeneDB

MirGeneDB ID

Cli-Mir-1329

Family name MIR-1329 (all species)
Seed ACAGUGA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-1329
Paralogues
Orthologues Aca-Mir-1329  Ami-Mir-1329  Bta-Mir-1329  Cpi-Mir-1329  Gga-Mir-1329  Mdo-Mir-1329  Oan-Mir-1329  Sha-Mir-1329  Sto-Mir-1329  Tgu-Mir-1329  Xtr-Mir-1329 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold102: 20718008-20718068 [+]
Precursor
(pre-Mir +30nt flank)
UAGAGACAAGUCUUGGUCUGGUUGUAGAGAUACAGUGAUCAGGUUACGAUGGAUUUCUCAAGUAACAACCUCGUAGCUUGAUCACGAUAUCCCUAUGACUUGAGAAACAACAGGUUUAACU
Get precursor sequence
Structure
        10          20        30        40        50        60
UAGAGACAAGUCUUGGU--|U   UG   A    CA               U  AUUUCUC 
                   C GGU  UAG GAUA  GUGAUCAGGUUACGA GG       A
                   G UCA  AUC CUAU  CACUAGUUCGAUGCU CC       A
UCAAUUUGGACAACAAAGA^U   GU   C    AG               -  AACAAUG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-1329_5p

MirBase accessionMIMAT0038672
Sequence
0- UACAGUGAUCAGGUUACGAUGGA -23
Get sequence
Star sequence

Cli-Mir-1329_3p*

MirBase accessionMIMAT0038673
Sequence
38- CCUCGUAGCUUGAUCACGAUAUC -61
Get sequence