MirGeneDB

MirGeneDB ID

Cli-Mir-126-v1

Family name MIR-126 (all species)
Seed AUUAUUA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-126
Paralogues Cli-Mir-126-v2  Cli-Mir-126-v3 
Orthologues Aca-Mir-126-v1  Ami-Mir-126-v1  Bta-Mir-126-v1  Cfa-Mir-126-v1  Cin-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Dno-Mir-126-v1  Ete-Mir-126-v1  Gga-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mml-Mir-126-v1  Mmu-Mir-126-v1  Oan-Mir-126-v1  Ocu-Mir-126-v1  Rno-Mir-126-v1  Sha-Mir-126-v1  Sto-Mir-126-v1  Tgu-Mir-126-v1  Xtr-Mir-126-v1 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(colLiv2)
scaffold642: 1958266-1958324 [-]
Clustered MiRNAs
(< 10kb from Mir-126-v1)
Mir-126-v1 scaffold642: 1958266-1958324 [-]
Mir-126-v2 scaffold642: 1958266-1958324 [-]
Mir-126-v3 scaffold642: 1958266-1958324 [-]
Precursor
(pre-Mir +30nt flank)
GAAGAGCAGCGGCCACCGCUGGUGACGGCCCAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGUGAGUAAUAAUGCGCUGUGGCCAGCACGGGCAUCAUGCAGUAAA
Get precursor sequence
Structure
        10          20        30        40        50         
GAAGAGCAGCGGCCACC--|     G     C           U       CGCUGUGAC 
                   GCUGGU ACGGC CAUUAUUACUU UGGUACG         \
                   CGACCG UGUCG GUAAUAAUGAG GCCAUGC         A
AAAUGACGUACUACGGGCA^     G     C           U       UCAAACUUC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-126-v1_5p

MirBase accessionMIMAT0038499
Sequence
0- CAUUAUUACUUUUGGUACGCG -21
Get sequence
Star sequence

Cli-Mir-126-v1_3p*

MirBase accessionMIMAT0038500
Sequence
38- CGUACCGUGAGUAAUAAUGCG -59
Get sequence