MirGeneDB

MirGeneDB ID

Cli-Mir-10-P2a

Family name MIR-10 (all species)
Seed ACCCGUA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-100-1
Paralogues Cli-Mir-10-P1a-v1  Cli-Mir-10-P1a-v2  Cli-Mir-10-P1b-v1  Cli-Mir-10-P1b-v2  Cli-Mir-10-P1c-v1  Cli-Mir-10-P1c-v2  Cli-Mir-10-P2c  Cli-Mir-10-P3a  Cli-Mir-10-P3c 
Orthologues Aae-Mir-10-P2  Aca-Mir-10-P2a  Ami-Mir-10-P2a  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Bta-Mir-10-P2a  Cfa-Mir-10-P2a  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cpi-Mir-10-P2a  Cpo-Mir-10-P2a  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dno-Mir-10-P2a  Dpu-Mir-10-P2  Dre-Mir-10-P2a1  Dre-Mir-10-P2a2  Ete-Mir-10-P2a  Gga-Mir-10-P2a  Hsa-Mir-10-P2a  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Mdo-Mir-10-P2a  Mml-Mir-10-P2a  Mmu-Mir-10-P2a  Oan-Mir-10-P2a  Ocu-Mir-10-P2a  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Rno-Mir-10-P2a  Sha-Mir-10-P2a  Sko-Mir-10-P2  Sto-Mir-10-P2a  Tca-Mir-10-P2  Tgu-Mir-10-P2a3  Tgu-Mir-10-P2a4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(colLiv2)
scaffold367: 869683-869739 [-]
Clustered MiRNAs
(< 10kb from Mir-10-P2a)
Let-7-P1a scaffold367: 862707-862773 [-]
Mir-10-P2a scaffold367: 869683-869739 [-]
Precursor
(pre-Mir +30nt flank)
UUACAGAAGAGAUCCGCGCCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGGUCAUAUUCCACACAAGCUUGUAUCUAUAGGUAUGUGUCUGUCUGGCAAGUGCACAAAGUGGUGU
Get precursor sequence
Structure
        10         20         30        40        50        
UUACAGAAGAGAUCCGC-   UGUUGC-|   A   CG     C   A      GUCAU 
                  GCC       CACA ACC  UAGAU CGA CUUGUG     \
                  CGG       GUGU UGG  AUCUA GUU GAACAC     A
UGUGGUGAAACACGUGAA   UCUGUCU^   A   AU     U   C      ACCUU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Cli-Mir-10-P2a_5p

MirBase accessionMIMAT0038480
Sequence
0- AACCCGUAGAUCCGAACUUGUG -22
Get sequence
Star sequence

Cli-Mir-10-P2a_3p*

MirBase accessionMIMAT0038481
Sequence
35- CAAGCUUGUAUCUAUAGGUAUG -57
Get sequence