MirGeneDB

MirGeneDB ID

Cin-Mir-124-P18

Family name MIR-124 (all species)
Seed AAGGCAC
Species Sea Squirt (Ciona intestinalis)
MiRBase ID cin-mir-124-2
Paralogues Cin-Mir-124-P17 
Orthologues Aae-Mir-124  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Tca-Mir-124 
Node of Origin (locus) C. intestinalis
Node of Origin (family) Bilateria
Genome context
(ci3)
7: 4969845-4969902 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-124-P18)
Mir-124-P17 7: 4969705-4969762 [-] UCSC Ensembl
Mir-124-P18 7: 4969845-4969902 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAUACUUGUUACGUCAUAGCUAUGUUCGGUAGUAUUUAUUGUGGACCUUGCUGUGUGACGUCACAAUAAGGCACGCGGUGAAUGCCAACGAAUUUUUGCUGCUUUCAUCUAUAAUGUU
Get precursor sequence
Structure
        10         20         30        40        50        
UAUACUUGUUACGUCAU-   UAU-|    GUA            GA     CUGUGUG 
                  AGC    GUUCG   GUAUUUAUUGUG  CCUUG       A
                  UCG    UAAGC   CGUAAGUGGCGC  GGAAU       C
UUGUAAUAUCUACUUUCG   UUUU^    AAC            AC     AACACUG 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Star sequence

Cin-Mir-124-P18_5p*

MirBase accessionMIMAT0015257
Sequence
0- AGUAUUUAUUGUGGACCUUGCU -22
Get sequence
Mature sequence

Cin-Mir-124-P18_3p

MirBase accessionMIMAT0006100
Sequence
36- UAAGGCACGCGGUGAAUGCCAA -58
Get sequence